Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11597
Trapped Gene
Zswim1 (ENSMUSG00000017764)
Vector Insertion
Chr 2: 164648701 - 164650181
Public Clones (sanger) (sanger) (sanger) (sanger) P026G06 (ggtc) E124D02 (ggtc)
P089E04 (ggtc) E124D02 (ggtc) IST14341C4 (tigm) IST14221A10 (tigm)
IST14384E5 (tigm) IST10016G10 (tigm) IST14626F8 (tigm)
Private Clones OST440381 (lexicon) OST350982 (lexicon) OST194915 (lexicon) OST46966 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171748 (Chr2:164648186..164648700 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171748 (Chr2:164648186..164648700 +)
Downstram Exon
ENSMUSE00000171747 (Chr2:164650182..164652367 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000171748 Chr2:164648186..164648700 No primer for this exon

*** Putative Vector Insertion (Chr 2: 164648701 - 164650181) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171747 Chr2:164650182..164652367 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTAATCGCCTTGCAGCAC Chr2:164648749..164648769 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGGACTCTATCGTGACTGG Chr2:164648740..164648761 60.12 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017764