Tools for the biologist enabling optimized use of gene trap clones
  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11614
Trapped Gene 
Manbal (ENSMUSG00000063019)
Vector Insertion 
Chr 2: 157193377 - 157204784
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) E326F05 (ggtc) (ggtc) D170F07 (ggtc)
M124E02 (ggtc) P076E09 (ggtc) E068F01 (ggtc) D084F08 (ggtc) E326F05 (ggtc)
(ggtc) P084A06 (ggtc) E068D12 (ggtc) D071A12 (ggtc) CMHD-GT_355D5-3 (cmhd)
FHCRC-GT-S18-10E1 (fhcrc) PST6381-NR (escells) IST13503A1 (tigm) IST14815D5 (tigm)
IST14521H4 (tigm) IST14499E10 (tigm) IST14167D3 (tigm) IST14648D9 (tigm)
IST12142C7BBF1 (tigm) IST11781C2 (tigm) IST12475D3 (tigm) IST14409D12 (tigm)
IST14290D12 (tigm) IST13026A8 (tigm) IST11668C9 (tigm) IST14722B8 (tigm)
IST11646H6 (tigm) IST14614C8 (tigm) IST10278D3 (tigm) IST14604H3 (tigm)
IST14398A3 (tigm) IST10083G4 (tigm) IST14729D9 (tigm) IST13568A9 (tigm)
IST14702G10 (tigm) IST10758G3 (tigm) IST14996E12 (tigm)
Private Clones OST466687 (lexicon) OST464558 (lexicon) OST448776 (lexicon) OST442927 (lexicon)
OST440238 (lexicon) OST393410 (lexicon) OST389882 (lexicon) OST389073 (lexicon)
OST383278 (lexicon) OST375043 (lexicon) OST369127 (lexicon) OST368512 (lexicon)
OST366658 (lexicon) OST353154 (lexicon) OST333036 (lexicon) OST330071 (lexicon)
OST320644 (lexicon) OST289423 (lexicon) OST282938 (lexicon) OST278158 (lexicon)
OST276606 (lexicon) OST270018 (lexicon) OST265615 (lexicon) OST264714 (lexicon)
OST262203 (lexicon) OST261239 (lexicon) OST246696 (lexicon) OST239578 (lexicon)
OST239492 (lexicon) OST237715 (lexicon) OST236906 (lexicon) OST236670 (lexicon)
OST236255 (lexicon) OST236098 (lexicon) OST233222 (lexicon) OST227174 (lexicon)
OST220994 (lexicon) OST209598 (lexicon) OST208742 (lexicon) OST207951 (lexicon)
OST203736 (lexicon) OST194500 (lexicon) OST186861 (lexicon) OST180294 (lexicon)
OST170953 (lexicon) OST155602 (lexicon) OST150352 (lexicon) OST149068 (lexicon)
OST148031 (lexicon) OST130431 (lexicon) OST129024 (lexicon) OST104971 (lexicon)
OST87775 (lexicon) OST77052 (lexicon) OST69098 (lexicon) OST69078 (lexicon)
OST37462 (lexicon) OST37072 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000471524 (Chr2:157193345..157193376 +)		 Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000471524 (Chr2:157193345..157193376 +)		 Downstram Exon
ENSMUSE00000468800 (Chr2:157204785..157204990 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTGGGAATGGGTACGATGAT Chr2:157204980..157204999 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471524 Chr2:157193345..157193376 No primer for this exon

*** Putative Vector Insertion (Chr 2: 157193377 - 157204784) ***
  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000468800 Chr2:157204785..157204990 TTGGGAATGGGTACGATGAT Chr2:157204980..157204999 60.01 45
downstream ENSMUSE00000469751 Chr2:157221646..157222498 CACAGCTGGAGCCTAAGGAC Chr2:157221929..157221948 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACAACTCTGTGGCATCTCA Chr2:157199335..157199356 58.87 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCACGAGGGATCACTTCC Chr2:157199332..157199352 61.87 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063019