Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11625
Trapped Gene
Pttg1ip (ENSMUSG00000009291)
Vector Insertion
Chr 10: 77050049 - 77052378
Public Clones P080A12 (ggtc) (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000102726 (Chr10:77049996..77050048 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000102726 (Chr10:77049996..77050048 +)
Downstram Exon
ENSMUSE00000102731 (Chr10:77052379..77052487 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410474 Chr10:77044498..77044672 No primer for this exon
upstream ENSMUSE00000102726 Chr10:77049996..77050048 No primer for this exon

*** Putative Vector Insertion (Chr 10: 77050049 - 77052378) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000102731 Chr10:77052379..77052487 No primer for this exon
downstream ENSMUSE00000102729 Chr10:77055591..77055762 No primer for this exon
downstream ENSMUSE00000102733 Chr10:77056609..77056655 No primer for this exon
downstream ENSMUSE00000415656 Chr10:77059773..77061476 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCAAGTCCAAGGAGGTGT Chr10:77050076..77050096 59.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTTGTCGTGACTGGGAAA Chr10:77050093..77050113 60.13 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009291