Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11630
Trapped Gene
1190007I07Rik (ENSMUSG00000063320)
Vector Insertion
Chr 10: 82082963 - 82085452
Public Clones P086C08 (ggtc)
Private Clones OST276754 (lexicon)
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000471887 (Chr10:82085453..82085569 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGTACTATCGGCCTGACC Chr10:82085455..82085474 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000471887 (Chr10:82085453..82085569 -)
Downstram Exon
ENSMUSE00000472757 (Chr10:82082603..82082962 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGTACTATCGGCCTGACC Chr10:82085455..82085474 59.96 55 GTTCGTGGCGTCTCTCTTTC Chr10:82082865..82082884 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000574489 Chr10:82085710..82085856 TAGTCGTGGGAAGGAACGAG Chr10:82085800..82085819 60.25 55
upstream ENSMUSE00000471887 Chr10:82085453..82085569 TTGGTACTATCGGCCTGACC Chr10:82085455..82085474 59.96 55

*** Putative Vector Insertion (Chr 10: 82082963 - 82085452) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000472757 Chr10:82082603..82082962 GTTCGTGGCGTCTCTCTTTC Chr10:82082865..82082884 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTGGTGAGTGCTGTAGGG Chr10:82085436..82085456 60.17 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTGGTGAGTGCTGTAGGG Chr10:82085436..82085456 60.17 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063320