Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1164
Trapped Gene
Plxna1 (ENSMUSG00000030084)
Vector Insertion
Chr 6: 89274681 - 89279377
Public Clones AZ0182 (sanger) IST12935H3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000558213 (Chr6:89279378..89279444 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCGAATCAGTGGCAGAGAA Chr6:89279424..89279443 60.8 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000558213 (Chr6:89279378..89279444 -)
Downstram Exon
ENSMUSE00000558212 (Chr6:89274534..89274680 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCGAATCAGTGGCAGAGAA Chr6:89279424..89279443 60.8 50 CTGCCGAATGAGCTTGTCTT Chr6:89274533..89274552 60.54 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386369 Chr6:89312401..89312592 No primer for this exon
upstream ENSMUSE00000362879 Chr6:89306452..89307712 ACCACCGCAAGGAACACTAC Chr6:89307169..89307188 60.03 55
upstream ENSMUSE00000334659 Chr6:89304850..89305032 AGGATTTCAACCAGCCACTG Chr6:89304982..89305001 60.11 50
upstream ENSMUSE00000370608 Chr6:89293963..89294103 AACCGCCAGTACCTCTATGC Chr6:89293979..89293998 59.22 55
upstream ENSMUSE00000420550 Chr6:89292945..89293045 TGTGGAAAGCTGTGTCCAGT Chr6:89293012..89293031 59.31 50
upstream ENSMUSE00000420544 Chr6:89292579..89292702 CTAGGCAGGATGCCTGTGAG Chr6:89292678..89292697 60.95 60
upstream ENSMUSE00000233784 Chr6:89292323..89292476 AGCTGGTGTCAACTGCTCCT Chr6:89292422..89292441 60.06 55
upstream ENSMUSE00000233777 Chr6:89291843..89291942 GTCCAAGGAGACAGGGAAGA Chr6:89291892..89291911 59.23 55
upstream ENSMUSE00000233774 Chr6:89290517..89290631 AAATACCGCCATGTTTGCAC Chr6:89290569..89290588 60.76 45
upstream ENSMUSE00000396401 Chr6:89287145..89287345 ACGAGTGCCTTTTCCACATC Chr6:89287214..89287233 60.12 50
upstream ENSMUSE00000233765 Chr6:89285391..89285487 GTGAACCTGTCGGTTGTGTG Chr6:89285432..89285451 60.05 55
upstream ENSMUSE00000233761 Chr6:89285122..89285315 CTGTTCCCTTCGTCACCACT Chr6:89285199..89285218 60.15 55
upstream ENSMUSE00000404633 Chr6:89284848..89284999 AGGGAGGGACTCGACTAACC Chr6:89284955..89284974 59.56 60
upstream ENSMUSE00000233749 Chr6:89284645..89284765 TGTCTGCGAGATTGGAGATG Chr6:89284743..89284762 59.94 50
upstream ENSMUSE00000405277 Chr6:89284270..89284406 ACACCGACCTTCTACCGTGT Chr6:89284387..89284406 59.5 55
upstream ENSMUSE00000350051 Chr6:89283000..89283167 ACCCCGAGGTGAAGTACAAC Chr6:89283053..89283072 58.92 55
upstream ENSMUSE00000400817 Chr6:89282675..89282768 GGTGGGACCCTCCTAACAGT Chr6:89282748..89282767 60.23 60
upstream ENSMUSE00000353005 Chr6:89282080..89282319 TTAGCCCTACTGGGCTCTTG Chr6:89282113..89282132 59.47 55
upstream ENSMUSE00000233692 Chr6:89281835..89281978 GCTCAACTACACGGTGCTCA Chr6:89281921..89281940 60.06 55
upstream ENSMUSE00000558216 Chr6:89281209..89281443 CTGTGCTCATCGCCTACAAA Chr6:89281300..89281319 60.01 50
upstream ENSMUSE00000195002 Chr6:89280330..89280472 TGTTTCCTGGGATTGAGGAC Chr6:89280354..89280373 59.9 50
upstream ENSMUSE00000233668 Chr6:89279552..89279808 TGTGGAGAAGTCGCTGACAC Chr6:89279778..89279797 60.03 55
upstream ENSMUSE00000558213 Chr6:89279378..89279444 ACCGAATCAGTGGCAGAGAA Chr6:89279424..89279443 60.8 50

*** Putative Vector Insertion (Chr 6: 89274681 - 89279377) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000558212 Chr6:89274534..89274680 CTGCCGAATGAGCTTGTCTT Chr6:89274533..89274552 60.54 50
downstream ENSMUSE00000558210 Chr6:89274248..89274407 ACAGTTCAGCCCCTTCACAG Chr6:89274320..89274339 60.3 55
downstream ENSMUSE00000558208 Chr6:89273568..89273671 GTGACGTCCTCGTCCTGAAG Chr6:89273598..89273617 60.86 60
downstream ENSMUSE00000194991 Chr6:89273230..89273326 GTTGTAGGCCGATGTCTGCT Chr6:89273251..89273270 60.28 55
downstream ENSMUSE00000558204 Chr6:89272725..89272915 AGGTGGTCGTGGTTCTTCAC Chr6:89272776..89272795 60.01 55
downstream ENSMUSE00000558200 Chr6:89272437..89272606 TGAGTCGTGGATCTGATGCT Chr6:89272444..89272463 59.37 50
downstream ENSMUSE00000558195 Chr6:89270851..89271063 GGATGTCGAACACGAACTGA Chr6:89270983..89271002 59.68 50
downstream ENSMUSE00000410651 Chr6:89270606..89270756 CAGGTAGGCGCTCATGTCTT Chr6:89270674..89270693 60.42 55
downstream ENSMUSE00000233605 Chr6:89268851..89269465 GGCCTAGCCTTGGGTATCTC Chr6:89268899..89268918 60.06 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACACTGGCAGAGGGTGTTA Chr6:89276392..89276412 59.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGACGTGACTGGGAAAAC Chr6:89279311..89279331 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GACTCCTCTTTGCCATTTGC Chr6:89276457..89276477 59.82 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GACTCCTCTTTGCCATTTGC Chr6:89276457..89276477 59.82 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030084