Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11641
Trapped Gene
Arih2 (ENSMUSG00000064145)
Vector Insertion
Chr 9: 108546700 - 108547263
Public Clones P095D04 (ggtc) P095D04 (ggtc) P095D04 (ggtc) CMHD-GT_268C9-3 (cmhd)
Private Clones OST311431 (lexicon) OST281463 (lexicon) OST212125 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000512727 (Chr9:108547264..108547325 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGTGATATCTGCAGGAAAG Chr9:108547281..108547301 60.08 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000512727 (Chr9:108547264..108547325 -)
Downstram Exon
ENSMUSE00000221357 (Chr9:108546357..108546699 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGTGATATCTGCAGGAAAG Chr9:108547281..108547301 60.08 47.62 CCAGCAAAGTTGCAGAAACA Chr9:108546595..108546614 60.03 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000516014 Chr9:108551560..108551711 GTCAGCCTGGTTTGGTCTGG Chr9:108551613..108551632 63.01 60
upstream ENSMUSE00000512727 Chr9:108547264..108547325 TGGGTGATATCTGCAGGAAAG Chr9:108547281..108547301 60.08 47.62

*** Putative Vector Insertion (Chr 9: 108546700 - 108547263) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221357 Chr9:108546357..108546699 CCAGCAAAGTTGCAGAAACA Chr9:108546595..108546614 60.03 45
downstream ENSMUSE00000221350 Chr9:108522390..108522457 CTCTGAGACTTGCCAGTGGA Chr9:108522379..108522398 59.12 55
downstream ENSMUSE00000221358 Chr9:108519703..108519766 GAACTCGAGCCTCAACAAGC Chr9:108519701..108519720 60.14 55
downstream ENSMUSE00000221365 Chr9:108519009..108519159 GTAGGTTTTCCTTCCGCACA Chr9:108519071..108519090 60.11 50
downstream ENSMUSE00000221361 Chr9:108517356..108517477 TCTGGTGTTCGAAGTGGACA Chr9:108517413..108517432 60.28 50
downstream ENSMUSE00000221353 Chr9:108516057..108516166 CTCCTGTACCCGGATAACCA Chr9:108516082..108516101 59.81 55
downstream ENSMUSE00000221363 Chr9:108513964..108514081 AGTCGTCTGCACACTTGGTG Chr9:108513980..108513999 59.94 55
downstream ENSMUSE00000221364 Chr9:108512228..108512278 CTTCTCGATGCAGATGTTGC Chr9:108512227..108512246 59.55 50
downstream ENSMUSE00000221351 Chr9:108512109..108512130 No primer for this exon
downstream ENSMUSE00000221352 Chr9:108510933..108511084 TCACTACCATGCGTCTTCCA Chr9:108511017..108511036 60.26 50
downstream ENSMUSE00000221355 Chr9:108510240..108510383 CAATCCAAGTTCCCAGGTTG Chr9:108510259..108510278 60.35 50
downstream ENSMUSE00000221362 Chr9:108509619..108509687 GGGACCGGATTCCATGTAGTA Chr9:108509609..108509629 60.94 52.38
downstream ENSMUSE00000511248 Chr9:108507665..108507748 TGTCTGCACGCTCAACTTTC Chr9:108507657..108507676 60.18 50
downstream ENSMUSE00000370226 Chr9:108505278..108507484 CCACAGCCCAGTTTAGGTGT Chr9:108507379..108507398 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr9:108547193..108547213 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGCAATGTACCCGTGACT Chr9:108547205..108547225 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGGGTGATATCTGCAGGAAAG Chr9:108547279..108547300 60.08 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGGTGATATCTGCAGGAAAG Chr9:108547279..108547300 60.08 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064145