Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11651
Trapped Gene
Clcn6 (ENSMUSG00000029016)
Vector Insertion
Chr 4: 147400709 - 147402658
Public Clones P077F10 (ggtc)
Private Clones OST132630 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000351519 (Chr4:147402659..147402724 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGATACGAGGCGGTGAAG Chr4:147402698..147402717 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000351519 (Chr4:147402659..147402724 -)
Downstram Exon
ENSMUSE00000184579 (Chr4:147400642..147400708 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGATACGAGGCGGTGAAG Chr4:147402698..147402717 59.84 55 ACGTTTGAACCACTCCGAAC Chr4:147400620..147400639 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000385468 Chr4:147412790..147412922 No primer for this exon
upstream ENSMUSE00000184557 Chr4:147412023..147412082 CTTGGGGAGACACAGGAAGA Chr4:147412057..147412076 60.23 55
upstream ENSMUSE00000398441 Chr4:147403496..147403561 GACTATGACCGCTGCATCAA Chr4:147403536..147403555 59.83 50
upstream ENSMUSE00000351519 Chr4:147402659..147402724 GAAGATACGAGGCGGTGAAG Chr4:147402698..147402717 59.84 55

*** Putative Vector Insertion (Chr 4: 147400709 - 147402658) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184579 Chr4:147400642..147400708 ACGTTTGAACCACTCCGAAC Chr4:147400620..147400639 60.01 50
downstream ENSMUSE00000184555 Chr4:147398218..147398324 GGTCAAGTTAAAGCCCAGGA Chr4:147398232..147398251 59.17 50
downstream ENSMUSE00000630346 Chr4:147398218..147398333 CCCTTCTGACTGCATTCCTC Chr4:147398278..147398297 59.8 55
downstream ENSMUSE00000184533 Chr4:147397476..147397602 CAATTCCTGGCACTTTCACA Chr4:147397511..147397530 59.69 45
downstream ENSMUSE00000356527 Chr4:147395569..147395636 GCTCCTACCACAGCACCACT Chr4:147395560..147395579 60.33 60
downstream ENSMUSE00000330995 Chr4:147393827..147393885 TGCGGAAGTAGGGGAAGTTA Chr4:147393812..147393831 59.7 50
downstream ENSMUSE00000184565 Chr4:147392950..147393082 TGGTTCCAGAAGGATGAACC Chr4:147392947..147392966 59.9 50
downstream ENSMUSE00000630345 Chr4:147392023..147392125 CCAGAGCGGAAGAAGTTGAG Chr4:147392054..147392073 60.13 55
downstream ENSMUSE00000184561 Chr4:147392012..147392125 CCAGAGCGGAAGAAGTTGAG Chr4:147392054..147392073 60.13 55
downstream ENSMUSE00000184572 Chr4:147391605..147391771 CACGACGAAGAAACCCAAAT Chr4:147391687..147391706 59.97 45
downstream ENSMUSE00000184545 Chr4:147390961..147391087 GGAAGACATCTGTCGGCATT Chr4:147390975..147390994 60.08 50
downstream ENSMUSE00000595540 Chr4:147390961..147391088 GGAAGACATCTGTCGGCATT Chr4:147390975..147390994 60.08 50
downstream ENSMUSE00000184543 Chr4:147388610..147388736 GATGGAAGAGCTGCAGGATG Chr4:147388594..147388613 60.91 55
downstream ENSMUSE00000184575 Chr4:147388241..147388394 GGGACAGATGTGCCAAAAGT Chr4:147388291..147388310 59.97 50
downstream ENSMUSE00000184559 Chr4:147387976..147388135 CAGGATGACTGTGAGGCTGA Chr4:147388008..147388027 59.98 55
downstream ENSMUSE00000184563 Chr4:147387785..147387891 GGACGTCATAAATGCCCTTG Chr4:147387821..147387840 60.33 50
downstream ENSMUSE00000184535 Chr4:147386726..147386912 TTATGAGCTGGTTGCCCTTC Chr4:147386724..147386743 60.21 50
downstream ENSMUSE00000184581 Chr4:147385081..147385238 CACGGGTCAGGATACTGGAT Chr4:147385195..147385214 59.8 55
downstream ENSMUSE00000184531 Chr4:147384763..147384919 GGGTATAGGTTGGGGTAGGG Chr4:147384871..147384890 59.42 60
downstream ENSMUSE00000184569 Chr4:147383008..147383115 ACAATCATTCGGGGATTCAG Chr4:147382987..147383006 59.75 45
downstream ENSMUSE00000330876 Chr4:147382790..147382915 GGGAGACGGTAAATGGTGAA Chr4:147382851..147382870 59.79 50
downstream ENSMUSE00000330868 Chr4:147380243..147380970 GAAGAAAGTTGGGCCAATGA Chr4:147380376..147380395 60.05 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATAATCGCCTTGCAGCAC Chr4:147402590..147402610 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCTGGTGAGTAGTGGAAG Chr4:147402643..147402663 59.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029016