Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11654
Trapped Gene
Ppib (ENSMUSG00000032383)
Vector Insertion
Chr 9: 65909388 - 65910795
Public Clones P085F09 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000471832 (Chr9:65909274..65909387 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGTCTTTGGACTCTTTGGAA Chr9:65909317..65909337 59.84 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000471832 (Chr9:65909274..65909387 +)
Downstram Exon
ENSMUSE00000532521 (Chr9:65910796..65910889 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGTCTTTGGACTCTTTGGAA Chr9:65909317..65909337 59.84 42.86 TCCTTGATGACACGATGGAA Chr9:65910845..65910864 60.05 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219272 Chr9:65908062..65908207 AGCGCAATATGAAGGTGCTC Chr9:65908089..65908108 60.38 50
upstream ENSMUSE00000471832 Chr9:65909274..65909387 TCGTCTTTGGACTCTTTGGAA Chr9:65909317..65909337 59.84 42.86

*** Putative Vector Insertion (Chr 9: 65909388 - 65910795) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000532521 Chr9:65910796..65910889 TCCTTGATGACACGATGGAA Chr9:65910845..65910864 60.05 45
downstream ENSMUSE00000532520 Chr9:65913294..65913478 AACTTTGCCGAAAACCACAT Chr9:65913469..65913488 59.48 40
downstream ENSMUSE00000357201 Chr9:65914102..65914428 TGGCTACCTTCGTCTGTGTG Chr9:65914304..65914323 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCCCACACAGTAGGGATG Chr9:65909399..65909419 59.7 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACCCCACACAGTAGGGATG Chr9:65909399..65909419 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032383