Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11663
Trapped Gene
Zfp42 (ENSMUSG00000051176)
Vector Insertion
Chr 8: 44389914 - 44392194
Public Clones (sanger) P145A03 (ggtc) P078C07 (ggtc) D101A04 (ggtc) D001H01 (ggtc)
P138E05 (ggtc) D041E08 (ggtc) P097G04 (ggtc) D031A06 (ggtc) FHCRC-GT-S11-7F1 (fhcrc)
PST465 (escells) PST1155 (escells) PST465-1 (escells) IST12365C5 (tigm)
IST14496H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000510068 (Chr8:44392195..44392290 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGGTACGAGTGGCAGTTT Chr8:44392265..44392284 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000510068 (Chr8:44392195..44392290 -)
Downstram Exon
ENSMUSE00000481791 (Chr8:44389830..44389913 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGGTACGAGTGGCAGTTT Chr8:44392265..44392284 60.17 55 CCACGTGTCCCAGCTCTTAG Chr8:44389863..44389882 60.84 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000510068 Chr8:44392195..44392290 CTGGGTACGAGTGGCAGTTT Chr8:44392265..44392284 60.17 55

*** Putative Vector Insertion (Chr 8: 44389914 - 44392194) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000481791 Chr8:44389830..44389913 CCACGTGTCCCAGCTCTTAG Chr8:44389863..44389882 60.84 60
downstream ENSMUSE00000706533 Chr8:44388229..44388333 CCAGCTTGGTCTGCAAAGTT Chr8:44388260..44388279 60.43 50
downstream ENSMUSE00000482761 Chr8:44385982..44386059 ATTTGGGGACAACACTTGGA Chr8:44385975..44385994 60.21 45
downstream ENSMUSE00000480945 Chr8:44380422..44381890 CTTTGCGTGGGTTAGGATGT Chr8:44380946..44380965 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCATGAAATGGCTGGGATT Chr8:44392162..44392182 60.27 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCATGAAATGGCTGGGATT Chr8:44392162..44392182 60.27 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGGGTACGAGTGGCAGTTT Chr8:44392263..44392283 60.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGGGTACGAGTGGCAGTTT Chr8:44392263..44392283 60.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051176