Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11687
Trapped Gene
Creld2 (ENSMUSG00000023272)
Vector Insertion
Chr 15: 88650265 - 88650360
Public Clones P080C08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000354774 (Chr15:88650076..88650264 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTGGACAAGTTCAACCAG Chr15:88650245..88650264 59.56 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000354774 (Chr15:88650076..88650264 +)
Downstram Exon
ENSMUSE00000312299 (Chr15:88650361..88650443 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTGGACAAGTTCAACCAG Chr15:88650245..88650264 59.56 50 AAATTCTTCCTGGCCGTGTT Chr15:88650392..88650411 60.86 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000354774 Chr15:88650076..88650264 TGGTGGACAAGTTCAACCAG Chr15:88650245..88650264 59.56 50

*** Putative Vector Insertion (Chr 15: 88650265 - 88650360) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000312299 Chr15:88650361..88650443 AAATTCTTCCTGGCCGTGTT Chr15:88650392..88650411 60.86 45
downstream ENSMUSE00000312290 Chr15:88650959..88651069 CTCCTGCTGCTCCAAGAGTT Chr15:88651043..88651062 59.74 55
downstream ENSMUSE00000312279 Chr15:88651565..88651656 AAATAGGTTGGGGTGCTCCT Chr15:88651592..88651611 59.83 50
downstream ENSMUSE00000312270 Chr15:88652389..88652565 AGATGCTGTGGGTCTCGTTC Chr15:88652562..88652581 60.27 55
downstream ENSMUSE00000134242 Chr15:88653497..88653592 TCTTTGTTGCTTGGACCAGA Chr15:88653545..88653564 59.42 45
downstream ENSMUSE00000134241 Chr15:88654172..88654255 GAGCCGTTGACATTCTCACA Chr15:88654244..88654263 59.84 50
downstream ENSMUSE00000134239 Chr15:88655078..88655173 TAGCCGGCAATACACTCCTT Chr15:88655150..88655169 59.73 50
downstream ENSMUSE00000134238 Chr15:88655580..88655720 CCCGGAACATTGTAGCAGTT Chr15:88655652..88655671 59.99 50
downstream ENSMUSE00000371779 Chr15:88656817..88657111 GCATCAGCTGTGTCCGAGTA Chr15:88657010..88657029 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTGGACAAGTTCAACCAG Chr15:88650246..88650266 59.56 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGGACAAGTTCAACCAG Chr15:88650246..88650266 59.56 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023272