Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11694
Trapped Gene
Sparc (ENSMUSG00000018593)
Vector Insertion
Chr 11: 55220782 - 55223429
Public Clones P086F07 (ggtc)
Private Clones OST376553 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000448048 (Chr11:55223430..55223499 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000448048 (Chr11:55223430..55223499 -)
Downstram Exon
ENSMUSE00000448030 (Chr11:55220722..55220781 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000448061 Chr11:55233290..55233351 No primer for this exon
upstream ENSMUSE00000678286 Chr11:55233290..55233400 No primer for this exon
upstream ENSMUSE00000448048 Chr11:55223430..55223499 No primer for this exon
upstream ENSMUSE00000708374 Chr11:55223430..55223499 No primer for this exon

*** Putative Vector Insertion (Chr 11: 55220782 - 55223429) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000448030 Chr11:55220722..55220781 No primer for this exon
downstream ENSMUSE00000678285 Chr11:55220722..55220778 No primer for this exon
downstream ENSMUSE00000448024 Chr11:55220012..55220099 No primer for this exon
downstream ENSMUSE00000448017 Chr11:55218682..55218803 No primer for this exon
downstream ENSMUSE00000307396 Chr11:55215453..55215573 No primer for this exon
downstream ENSMUSE00000307389 Chr11:55212694..55212827 No primer for this exon
downstream ENSMUSE00000102602 Chr11:55212050..55212198 No primer for this exon
downstream ENSMUSE00000102587 Chr11:55209303..55209451 No primer for this exon
downstream ENSMUSE00000678288 Chr11:55208939..55209115 No primer for this exon
downstream ENSMUSE00000448041 Chr11:55208002..55209115 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATCCCGCTTTCTCCATAA Chr11:55223375..55223395 60.54 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCACGTGACTGGGAAAAC Chr11:55223363..55223383 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018593