Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11722
Trapped Gene
Wwp2 (ENSMUSG00000031930)
Vector Insertion
Chr 8: 110042012 - 110057099
Public Clones P029H06 (ggtc) D094D08 (ggtc) D094D08 (ggtc) E114F05 (ggtc) CMHD-GT_326H4-3 (cmhd)
Private Clones OST293250 (lexicon) OST33577 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000423186 (Chr8:110041801..110042011 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGCCTTGAGTGTGTCCT Chr8:110041871..110041890 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000423186 (Chr8:110041801..110042011 +)
Downstram Exon
ENSMUSE00000423183 (Chr8:110057100..110057189 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGCCTTGAGTGTGTCCT Chr8:110041871..110041890 60.06 55 GTGGTGGTCTTGGTGTTGTG Chr8:110057168..110057187 59.89 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000423226 Chr8:109960317..109960341 No primer for this exon
upstream ENSMUSE00000214780 Chr8:109976879..109976963 GAAGTCCCAGCTTACCCTGA Chr8:109976941..109976960 59.28 55
upstream ENSMUSE00000214760 Chr8:109981343..109981490 AGACCAAGAAGACGGGGAAG Chr8:109981427..109981446 60.62 55
upstream ENSMUSE00000214778 Chr8:109981780..109981901 ACAGCCCAGAGTCATTTGGA Chr8:109981787..109981806 60.66 50
upstream ENSMUSE00000423204 Chr8:110007232..110007369 GATGGGCCAACTGTTGATCT Chr8:110007315..110007334 59.93 50
upstream ENSMUSE00000423202 Chr8:110009446..110009542 GAGAATCCAGTGGGACTGCT Chr8:110009464..110009483 59.26 55
upstream ENSMUSE00000423195 Chr8:110030207..110030334 GACGCACAGACACTCAGGTG Chr8:110030207..110030226 60.53 60
upstream ENSMUSE00000423186 Chr8:110041801..110042011 AGCAGCCTTGAGTGTGTCCT Chr8:110041871..110041890 60.06 55

*** Putative Vector Insertion (Chr 8: 110042012 - 110057099) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000423183 Chr8:110057100..110057189 GTGGTGGTCTTGGTGTTGTG Chr8:110057168..110057187 59.89 55
downstream ENSMUSE00000423177 Chr8:110064524..110064698 CTGCCACTGCTCATAGTTGC Chr8:110064641..110064660 59.62 55
downstream ENSMUSE00000423173 Chr8:110069344..110069398 TCAGTCGAAGCACTCGAAGA Chr8:110069366..110069385 59.85 50
downstream ENSMUSE00000423167 Chr8:110072369..110072450 TCCATTGTCCTGCCTCTTCT Chr8:110072391..110072410 59.8 50
downstream ENSMUSE00000423161 Chr8:110072929..110073057 CCCTCGCTGGTGTATTTCAT Chr8:110072988..110073007 59.96 50
downstream ENSMUSE00000423157 Chr8:110073360..110073435 ACTTCGGTCATAGGCACCAG Chr8:110073399..110073418 60.13 55
downstream ENSMUSE00000423152 Chr8:110073681..110073752 TGGAAACGCTGATCTTCACA Chr8:110073723..110073742 60.39 45
downstream ENSMUSE00000423146 Chr8:110073947..110074035 CGCAGGTCGTAAGGTTTCAT Chr8:110073978..110073997 60.13 50
downstream ENSMUSE00000580160 Chr8:110076177..110076336 CTGCCGATAAAGCGGAAGTA Chr8:110076326..110076345 60.36 50
downstream ENSMUSE00000423133 Chr8:110077869..110078002 TGTTGAGCATCCGCTTGTAG Chr8:110077938..110077957 60.01 50
downstream ENSMUSE00000423127 Chr8:110078333..110078473 TCTCCTCGGTAACTCGGATG Chr8:110078457..110078476 60.21 55
downstream ENSMUSE00000423124 Chr8:110078881..110079001 CAACCTCATTGAAGCCATCC Chr8:110078960..110078979 60.46 50
downstream ENSMUSE00000423118 Chr8:110079314..110079418 CTGCCAGTCGCTCATGTCTA Chr8:110079361..110079380 60.16 55
downstream ENSMUSE00000580159 Chr8:110080361..110080457 GTAGCCGGATCCTCTTCTCA Chr8:110080403..110080422 59.39 55
downstream ENSMUSE00000422582 Chr8:110080612..110080684 CCAACTCTGTCGATGCAGAA Chr8:110080654..110080673 59.98 50
downstream ENSMUSE00000423213 Chr8:110080787..110081112 AACCCCTCAGTCTCCTCGAT Chr8:110080876..110080895 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCGTGGGGTATAGACATAG Chr8:110056966..110056987 60.59 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCGTGGGGTATAGACATAG Chr8:110056966..110056987 60.59 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031930