Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11724
Trapped Gene
Crtap (ENSMUSG00000032431)
Vector Insertion
Chr 9: 114289174 - 114290703
Public Clones G063G12 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219716 (Chr9:114290704..114290832 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGAAATTTGTGGCGACCAT Chr9:114290736..114290755 59.94 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219716 (Chr9:114290704..114290832 -)
Downstram Exon
ENSMUSE00000219712 (Chr9:114289028..114289173 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGAAATTTGTGGCGACCAT Chr9:114290736..114290755 59.94 45 CTTGTCCCGGTGGTACTGAT Chr9:114289042..114289061 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221855 Chr9:114299250..114299785 CGAGCCCTACAAGTTTCTGC Chr9:114299267..114299286 60.01 55
upstream ENSMUSE00000583061 Chr9:114295320..114295469 GCCGAGGACCACATTAAAGA Chr9:114295342..114295361 60.07 50
upstream ENSMUSE00000221841 Chr9:114293814..114293985 TACAACGGGGAGAACTGGAG Chr9:114293939..114293958 60.1 55
upstream ENSMUSE00000219716 Chr9:114290704..114290832 GAGAAATTTGTGGCGACCAT Chr9:114290736..114290755 59.94 45

*** Putative Vector Insertion (Chr 9: 114289174 - 114290703) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000219712 Chr9:114289028..114289173 CTTGTCCCGGTGGTACTGAT Chr9:114289042..114289061 59.84 55
downstream ENSMUSE00000219713 Chr9:114287158..114287241 TGGAGCGTCGTCACATTAAA Chr9:114287185..114287204 60.26 45
downstream ENSMUSE00000221668 Chr9:114284262..114284700 TTTCTGAACATGGGGGAGAC Chr9:114284334..114284353 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTGTGGCGACCATGTACC Chr9:114290729..114290749 60.65 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTGTGGCGACCATGTACC Chr9:114290729..114290749 60.65 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032431