Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11727
Trapped Gene
Ppp1r7 (ENSMUSG00000026275)
Vector Insertion
Chr 1: 95246958 - 95247525
Public Clones G064D01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000157468 (Chr1:95246902..95246957 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGGAAACCATCAACCTGGA Chr1:95246925..95246944 60.17 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000157468 (Chr1:95246902..95246957 +)
Downstram Exon
ENSMUSE00000157466 (Chr1:95247526..95247591 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGGAAACCATCAACCTGGA Chr1:95246925..95246944 60.17 45 TTTAGCACCTCCAAGCCTTC Chr1:95247584..95247603 59.45 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406941 Chr1:95240221..95240288 AGTCGCAGGAGATGATGGAG Chr1:95240268..95240287 60.37 55
upstream ENSMUSE00000157469 Chr1:95242733..95242864 GAGTAGATCGGGGTGCAGAA Chr1:95242835..95242854 60.22 55
upstream ENSMUSE00000157468 Chr1:95246902..95246957 ATGGAAACCATCAACCTGGA Chr1:95246925..95246944 60.17 45

*** Putative Vector Insertion (Chr 1: 95246958 - 95247525) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000157466 Chr1:95247526..95247591 TTTAGCACCTCCAAGCCTTC Chr1:95247584..95247603 59.45 50
downstream ENSMUSE00000157467 Chr1:95248083..95248213 AGGTTTTGACGAAGGCAGAG Chr1:95248108..95248127 59.47 50
downstream ENSMUSE00000157470 Chr1:95249094..95249256 GCTCCAACATTTGCAGTTGA Chr1:95249239..95249258 59.85 45
downstream ENSMUSE00000157465 Chr1:95250906..95251022 GCACACTGAGGACTGTCAGG Chr1:95251023..95251042 59.44 60
downstream ENSMUSE00000493368 Chr1:95254334..95254438 CCTCGATACCATTGTTGCTG Chr1:95254418..95254437 59.15 50
downstream ENSMUSE00000500447 Chr1:95257303..95257389 No primer for this exon
downstream ENSMUSE00000502775 Chr1:95261467..95261851 AGGGCTCAGAACCTGACGTA Chr1:95261651..95261670 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr1:95247007..95247027 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000026275