Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11764
Trapped Gene
Tex14 (ENSMUSG00000010342)
Vector Insertion
Chr 11: 87218673 - 87247310
Public Clones (sanger) (sanger) (sanger) A037D07 (ggtc) 3SD148F01 (ggtc) E125G04 (ggtc)
5SD088A03 (ggtc) 5SE041A03 (ggtc) IST12442C5 (tigm) IST11643H11 (tigm)
IST14950G9 (tigm) IST12044H10 (tigm) IST12778A3 (tigm) IST14188G3 (tigm)
IST11934G1 (tigm) IST11197G10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675049 (Chr11:87218567..87218672 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675049 (Chr11:87218567..87218672 +)
Downstram Exon
ENSMUSE00000336125 (Chr11:87247311..87247447 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675049 Chr11:87218567..87218672 No primer for this exon

*** Putative Vector Insertion (Chr 11: 87218673 - 87247310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000336125 Chr11:87247311..87247447 No primer for this exon
downstream ENSMUSE00000475040 Chr11:87247312..87247447 No primer for this exon
downstream ENSMUSE00000379158 Chr11:87287906..87288020 No primer for this exon
downstream ENSMUSE00000675056 Chr11:87298202..87298367 No primer for this exon
downstream ENSMUSE00000457623 Chr11:87299751..87299887 No primer for this exon
downstream ENSMUSE00000649285 Chr11:87299771..87299887 No primer for this exon
downstream ENSMUSE00000105359 Chr11:87306542..87306623 No primer for this exon
downstream ENSMUSE00000649284 Chr11:87306542..87306623 No primer for this exon
downstream ENSMUSE00000457620 Chr11:87308454..87308584 No primer for this exon
downstream ENSMUSE00000649283 Chr11:87308454..87308584 No primer for this exon
downstream ENSMUSE00000105368 Chr11:87309702..87309815 No primer for this exon
downstream ENSMUSE00000675048 Chr11:87309702..87309815 No primer for this exon
downstream ENSMUSE00000268288 Chr11:87311332..87311455 No primer for this exon
downstream ENSMUSE00000675047 Chr11:87311332..87311455 No primer for this exon
downstream ENSMUSE00000268279 Chr11:87312986..87313164 No primer for this exon
downstream ENSMUSE00000675046 Chr11:87312986..87313164 No primer for this exon
downstream ENSMUSE00000105351 Chr11:87323070..87323221 No primer for this exon
downstream ENSMUSE00000675045 Chr11:87323070..87323221 No primer for this exon
downstream ENSMUSE00000105374 Chr11:87324927..87325117 No primer for this exon
downstream ENSMUSE00000675044 Chr11:87324927..87325117 No primer for this exon
downstream ENSMUSE00000105350 Chr11:87325635..87325785 No primer for this exon
downstream ENSMUSE00000675043 Chr11:87325635..87325785 No primer for this exon
downstream ENSMUSE00000105363 Chr11:87327444..87328363 No primer for this exon
downstream ENSMUSE00000675042 Chr11:87327444..87328363 No primer for this exon
downstream ENSMUSE00000586398 Chr11:87330170..87330276 No primer for this exon
downstream ENSMUSE00000675041 Chr11:87330170..87330276 No primer for this exon
downstream ENSMUSE00000586397 Chr11:87333157..87333239 No primer for this exon
downstream ENSMUSE00000675040 Chr11:87333157..87333239 No primer for this exon
downstream ENSMUSE00000586396 Chr11:87334140..87334421 No primer for this exon
downstream ENSMUSE00000675039 Chr11:87334140..87334421 No primer for this exon
downstream ENSMUSE00000105361 Chr11:87335997..87336097 No primer for this exon
downstream ENSMUSE00000105349 Chr11:87341346..87341412 No primer for this exon
downstream ENSMUSE00000105379 Chr11:87345849..87345930 No primer for this exon
downstream ENSMUSE00000105364 Chr11:87347041..87347103 No primer for this exon
downstream ENSMUSE00000105370 Chr11:87349035..87349162 No primer for this exon
downstream ENSMUSE00000105358 Chr11:87350197..87350402 No primer for this exon
downstream ENSMUSE00000105353 Chr11:87352068..87352164 No primer for this exon
downstream ENSMUSE00000105352 Chr11:87352498..87352572 No primer for this exon
downstream ENSMUSE00000649249 Chr11:87352506..87352572 No primer for this exon
downstream ENSMUSE00000105373 Chr11:87355992..87356069 No primer for this exon
downstream ENSMUSE00000105366 Chr11:87356786..87356879 No primer for this exon
downstream ENSMUSE00000105367 Chr11:87362934..87363026 No primer for this exon
downstream ENSMUSE00000105378 Chr11:87365033..87365142 No primer for this exon
downstream ENSMUSE00000105377 Chr11:87368430..87368481 No primer for this exon
downstream ENSMUSE00000339599 Chr11:87368986..87369324 No primer for this exon
downstream ENSMUSE00000649255 Chr11:87368986..87369325 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAATTTGATAATCGCCTTGC Chr11:87230715..87230736 60.76 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACGTGACTGGGAAAACC Chr11:87230720..87230740 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010342