Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11774
Trapped Gene
Pscd2 (ENSMUSG00000003269)
Vector Insertion
Chr 7: 53069249 - 53069467
Public Clones E122C07 (ggtc) (ggtc) A050B06 (ggtc) D153C08 (ggtc) E122C07 (ggtc)
D153C08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674237 (Chr7:53069468..53069652 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674237 (Chr7:53069468..53069652 -)
Downstram Exon
ENSMUSE00000674229 (Chr7:53068379..53069248 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355188 Chr7:53069468..53069683 No primer for this exon
upstream ENSMUSE00000674237 Chr7:53069468..53069652 No primer for this exon
upstream ENSMUSE00000674240 Chr7:53069468..53069681 No primer for this exon

*** Putative Vector Insertion (Chr 7: 53069249 - 53069467) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000226277 Chr7:53068379..53068526 No primer for this exon
downstream ENSMUSE00000674229 Chr7:53068379..53069248 No primer for this exon
downstream ENSMUSE00000497246 Chr7:53068217..53068283 No primer for this exon
downstream ENSMUSE00000531726 Chr7:53067550..53067668 No primer for this exon
downstream ENSMUSE00000531725 Chr7:53066899..53066979 No primer for this exon
downstream ENSMUSE00000531723 Chr7:53066224..53066336 No primer for this exon
downstream ENSMUSE00000531722 Chr7:53065941..53066089 No primer for this exon
downstream ENSMUSE00000531721 Chr7:53065497..53065608 No primer for this exon
downstream ENSMUSE00000674236 Chr7:53065493..53065608 No primer for this exon
downstream ENSMUSE00000531720 Chr7:53063743..53063819 No primer for this exon
downstream ENSMUSE00000674234 Chr7:53063743..53063848 No primer for this exon
downstream ENSMUSE00000674241 Chr7:53063743..53063822 No primer for this exon
downstream ENSMUSE00000531719 Chr7:53063546..53063617 No primer for this exon
downstream ENSMUSE00000531717 Chr7:53063303..53063457 No primer for this exon
downstream ENSMUSE00000674228 Chr7:53063051..53063218 No primer for this exon
downstream ENSMUSE00000674230 Chr7:53063019..53063218 No primer for this exon
downstream ENSMUSE00000484153 Chr7:53062958..53063218 No primer for this exon
downstream ENSMUSE00000674239 Chr7:53062009..53063218 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCATGGAGGACGGTGTCTAC Chr7:53069467..53069487 60.39 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGGAGGACGGTGTCTAC Chr7:53069467..53069487 60.39 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGATTGGGTGGTGTCAAAG Chr7:53069678..53069698 58.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGATTGGGTGGTGTCAAAG Chr7:53069678..53069698 58.98 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003269