Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11791
Trapped Gene
Snx18 (ENSMUSG00000042364)
Vector Insertion
Chr 13: 114385071 - 114407009
Public Clones (sanger) (sanger) M080E01 (ggtc) IST13094D9 (tigm) IST14830D4 (tigm)
IST13094D9 (tigm) IST10123F2 (tigm) IST10123F3 (tigm) IST13059G6 (tigm)
IST10867C9HMF1 (tigm) IST10920G6 (tigm)
Private Clones OST425102 (lexicon) OST380962 (lexicon) OST348509 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307141 (Chr13:114407010..114407838 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGTCTGATCTGGTGGATG Chr13:114407551..114407570 59.92 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307141 (Chr13:114407010..114407838 -)
Downstram Exon
ENSMUSE00000469182 (Chr13:114382393..114385070 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGTCTGATCTGGTGGATG Chr13:114407551..114407570 59.92 55 GCACTTCTCATCGCGTACAA Chr13:114383728..114383747 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000307151 Chr13:114407995..114408603 GCAGCTCTACGGTGGATACC Chr13:114408198..114408217 59.72 60
upstream ENSMUSE00000307145 Chr13:114407840..114407992 GCTTCTCCACCTTCGTCAAG Chr13:114407920..114407939 59.99 55
upstream ENSMUSE00000307141 Chr13:114407010..114407838 AGGGTCTGATCTGGTGGATG Chr13:114407551..114407570 59.92 55
upstream ENSMUSE00000679585 Chr13:114407010..114408772 TATCAGAAGGTGGGCCAGTC Chr13:114407222..114407241 60.07 55

*** Putative Vector Insertion (Chr 13: 114385071 - 114407009) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000469182 Chr13:114382393..114385070 GCACTTCTCATCGCGTACAA Chr13:114383728..114383747 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCAACGTCTGCAAGTTCT Chr13:114391985..114392005 60.06 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCAACGTCTGCAAGTTCT Chr13:114391985..114392005 60.06 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGGGAGGGGTCTTTTTACC Chr13:114401843..114401863 59.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCTCGAGAACCATCAGCTT Chr13:114392818..114392838 59.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042364