Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11796
Trapped Gene
Son (ENSMUSG00000022961)
Vector Insertion
Chr 16: 91675794 - 91677649
Public Clones A008A04 (ggtc) A071D05 (ggtc) A008F03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000393322 (Chr16:91675646..91675793 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGAATGGGAGCTGTTTTGA Chr16:91675678..91675697 59.67 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000393322 (Chr16:91675646..91675793 +)
Downstram Exon
ENSMUSE00000248514 (Chr16:91677650..91677721 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGAATGGGAGCTGTTTTGA Chr16:91675678..91675697 59.67 45 CCAGAACGCTTTTGTGCTCT Chr16:91677692..91677711 60.57 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718814 Chr16:91647751..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000248625 Chr16:91648069..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000709905 Chr16:91648124..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000715014 Chr16:91648130..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000132163 Chr16:91651875..91652041 ATACGGAGCTGCGGTACAAG Chr16:91652018..91652037 60.29 55
upstream ENSMUSE00000248612 Chr16:91654856..91656948 ACTGGAGCTGCCTAAGACCA Chr16:91655679..91655698 60.01 55
upstream ENSMUSE00000697861 Chr16:91654856..91660825 CTCGGAGTAAGCGTTCCAAG Chr16:91660157..91660176 60.01 55
upstream ENSMUSE00000248597 Chr16:91657069..91660825 CTCGGAGTAAGCGTTCCAAG Chr16:91660157..91660176 60.01 55
upstream ENSMUSE00000421977 Chr16:91662346..91662506 CCTGCACCTCCACCTACAAT Chr16:91662432..91662451 59.99 55
upstream ENSMUSE00000697840 Chr16:91662737..91663553 TGTTCACTGATCGCCAAGAG Chr16:91662845..91662864 59.98 50
upstream ENSMUSE00000248551 Chr16:91664443..91664589 AGTGAACCCAAGCCCATTTT Chr16:91664557..91664576 60.72 45
upstream ENSMUSE00000248543 Chr16:91664879..91665067 GTGGGTTCCAGTCGAGAAAA Chr16:91664992..91665011 60.09 50
upstream ENSMUSE00000718854 Chr16:91665165..91665953 TGAAAAGCATCGAATTGCAG Chr16:91665272..91665291 59.95 40
upstream ENSMUSE00000248535 Chr16:91670709..91670819 AATGAGTGAACGGGCACTTG Chr16:91670729..91670748 61.1 50
upstream ENSMUSE00000555840 Chr16:91671594..91671710 TCTATCCCTGGGCAGTTCAC Chr16:91671618..91671637 60.07 55
upstream ENSMUSE00000393322 Chr16:91675646..91675793 AGGAATGGGAGCTGTTTTGA Chr16:91675678..91675697 59.67 45

*** Putative Vector Insertion (Chr 16: 91675794 - 91677649) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248514 Chr16:91677650..91677721 CCAGAACGCTTTTGTGCTCT Chr16:91677692..91677711 60.57 50
downstream ENSMUSE00000248507 Chr16:91677834..91677949 AGAGGAAATGTTTGCGATGG Chr16:91677947..91677966 60.07 45
downstream ENSMUSE00000394089 Chr16:91678346..91679437 AAGTGGCATTAGCCATGAGG Chr16:91678534..91678553 60.1 50
downstream ENSMUSE00000716529 Chr16:91678346..91679466 AAGTGGCATTAGCCATGAGG Chr16:91678534..91678553 60.1 50
downstream ENSMUSE00000714116 Chr16:91678399..91679452 AAGTGGCATTAGCCATGAGG Chr16:91678534..91678553 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000022961