Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11803
Trapped Gene
Fgfr2 (ENSMUSG00000030849)
Vector Insertion
Chr 7: 137405262 - 137405372
Public Clones G020D11 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716564 (Chr7:137405263..137405371 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGCCCTCCTTCAGTTTAGT Chr7:137405289..137405308 60.62 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716564 (Chr7:137405263..137405371 -)
Downstram Exon
ENSMUSE00000710503 (Chr7:137405263..137405580 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGCCCTCCTTCAGTTTAGT Chr7:137405289..137405308 60.62 55 GTGGACGGTAATCCCATCTG Chr7:137405390..137405409 60.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000477371 Chr7:137409308..137410322 CACCAAAGCTGGCTAGGAAC Chr7:137410038..137410057 59.88 55
upstream ENSMUSE00000718635 Chr7:137409308..137409759 TCCTAGCTGTTCTGCGATCC Chr7:137409462..137409481 60.5 55
upstream ENSMUSE00000721642 Chr7:137409308..137409777 TCCTAGCTGTTCTGCGATCC Chr7:137409462..137409481 60.5 55
upstream ENSMUSE00000721980 Chr7:137409308..137409705 TCCTAGCTGTTCTGCGATCC Chr7:137409462..137409481 60.5 55
upstream ENSMUSE00000478888 Chr7:137405263..137405580 CAGATGGGATTACCGTCCAC Chr7:137405412..137405431 60.19 55
upstream ENSMUSE00000710503 Chr7:137405263..137405580 CAGATGGGATTACCGTCCAC Chr7:137405412..137405431 60.19 55
upstream ENSMUSE00000716564 Chr7:137405263..137405371 CGGCCCTCCTTCAGTTTAGT Chr7:137405289..137405308 60.62 55

*** Putative Vector Insertion (Chr 7: 137405262 - 137405372) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000485129 Chr7:137385892..137386158 AGGCCGGAGTCTCTAGGTGT Chr7:137385935..137385954 60.27 60
downstream ENSMUSE00000498100 Chr7:137384714..137384791 TGTCGTCCTCATCATCTCCA Chr7:137384737..137384756 60.21 50
downstream ENSMUSE00000462396 Chr7:137372137..137372306 CTTCTCGGTGTTGGTCCAGT Chr7:137372256..137372275 60.15 55
downstream ENSMUSE00000473564 Chr7:137362512..137362635 GTCTGACGGGACCACACTTT Chr7:137362563..137362582 60.01 55
downstream ENSMUSE00000438004 Chr7:137344497..137344687 CGCTGTAAACCTTGCAGACA Chr7:137344567..137344586 60.05 50
downstream ENSMUSE00000382019 Chr7:137343272..137343419 TCCATCTCCGTCACATTGAA Chr7:137343336..137343355 60.05 45
downstream ENSMUSE00000484156 Chr7:137341933..137342077 ATAGAATTACCCGCCAAGCA Chr7:137341952..137341971 59.57 45
downstream ENSMUSE00000669014 Chr7:137339723..137339888 TGCAGGCGATTAAGAAGACC Chr7:137339780..137339799 60.35 50
downstream ENSMUSE00000709836 Chr7:137339692..137339888 TGCAGGCGATTAAGAAGACC Chr7:137339780..137339799 60.35 50
downstream ENSMUSE00000414360 Chr7:137339686..137339888 TGCAGGCGATTAAGAAGACC Chr7:137339780..137339799 60.35 50
downstream ENSMUSE00000471727 Chr7:137328743..137328894 CAGACGCGTTGTTATCCTCA Chr7:137328807..137328826 59.86 50
downstream ENSMUSE00000477604 Chr7:137326155..137326276 GACTACTTGCCCGAAGCAAC Chr7:137326206..137326225 59.88 55
downstream ENSMUSE00000526704 Chr7:137323879..137323989 No primer for this exon
downstream ENSMUSE00000204297 Chr7:137321189..137321379 AGCTGGTAGGTGCAGGACAC Chr7:137321201..137321220 60.33 60
downstream ENSMUSE00000526702 Chr7:137316331..137316453 GGCCAAAGTCTGCTATCTTCA Chr7:137316356..137316376 59.47 47.62
downstream ENSMUSE00000305166 Chr7:137315126..137315196 AGGAGCCATCCACTTGACTG Chr7:137315145..137315164 60.26 55
downstream ENSMUSE00000305157 Chr7:137313253..137313390 TAGGGTGAGCCCCCTAAAGT Chr7:137313315..137313334 59.96 55
downstream ENSMUSE00000526700 Chr7:137311217..137311322 TTCGACCAACTGCTTGAATG Chr7:137311231..137311250 59.84 45
downstream ENSMUSE00000715505 Chr7:137307473..137307637 GAATCGTCCCCTGAAGAACA Chr7:137307530..137307549 60.05 50
downstream ENSMUSE00000715629 Chr7:137307473..137307731 TACGGTTCGAGAGGCTGACT Chr7:137307673..137307692 60.01 55
downstream ENSMUSE00000708267 Chr7:137307223..137307637 GAATCGTCCCCTGAAGAACA Chr7:137307530..137307549 60.05 50
downstream ENSMUSE00000710295 Chr7:137306026..137307637 CATCGGACAGCAGAGTTGAA Chr7:137306616..137306635 59.98 50
downstream ENSMUSE00000424613 Chr7:137305967..137307637 CATCGGACAGCAGAGTTGAA Chr7:137306616..137306635 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGGTCACCATGGCAATAA Chr7:137405318..137405338 59.4 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCATCTGCCTGGTCTTGGT Chr7:137405332..137405352 60.66 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030849