Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11805
Trapped Gene
Galnt2 (ENSMUSG00000031977)
Vector Insertion
Chr 8: 126862470 - 126864718
Public Clones W181A02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000284126 (Chr8:126862343..126862469 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTACAGCAGGGAACCAAC Chr8:126862375..126862394 59.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000284126 (Chr8:126862343..126862469 +)
Downstram Exon
ENSMUSE00000284105 (Chr8:126864719..126864838 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTACAGCAGGGAACCAAC Chr8:126862375..126862394 59.59 55 AACGGTCCACCACAGTAAGG Chr8:126864788..126864807 59.88 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344723 Chr8:126755294..126755549 CTGGGCATCGCCTACTACAT Chr8:126755475..126755494 60.12 55
upstream ENSMUSE00000400716 Chr8:126819258..126819351 ACCTTCACCACAGCAGAGGA Chr8:126819295..126819314 60.86 55
upstream ENSMUSE00000466841 Chr8:126829415..126829568 CATACGTTGGCGGTACAATG Chr8:126829448..126829467 59.87 50
upstream ENSMUSE00000385527 Chr8:126847572..126847670 TTCCACAATGAAGCCAGGTC Chr8:126847627..126847646 61.05 50
upstream ENSMUSE00000284313 Chr8:126847892..126847959 CCTGGTGGATGACTACAGCA Chr8:126847934..126847953 59.7 55
upstream ENSMUSE00000284296 Chr8:126848171..126848236 CCTCAGAAATGACCGGAGAG Chr8:126848214..126848233 59.8 55
upstream ENSMUSE00000284281 Chr8:126851992..126852113 No primer for this exon
upstream ENSMUSE00000215394 Chr8:126853613..126853700 ATCCCCCATTATCGATGTCA Chr8:126853630..126853649 59.97 45
upstream ENSMUSE00000215395 Chr8:126855909..126855996 ACATGACACCAGAGCAGAGG Chr8:126855942..126855961 58.83 55
upstream ENSMUSE00000215391 Chr8:126856468..126856571 AGAGCTGGGGAAGTACGACA Chr8:126856519..126856538 59.87 55
upstream ENSMUSE00000215399 Chr8:126858175..126858301 AGCAGCATCCCTACACGTTC Chr8:126858253..126858272 60.28 55
upstream ENSMUSE00000215397 Chr8:126860474..126860566 GCTGAAGTCTGGATGGATGAG Chr8:126860490..126860510 59.82 52.38
upstream ENSMUSE00000284138 Chr8:126861162..126861245 AGCCCTTCAAGTGGTACCTG Chr8:126861203..126861222 59.21 55
upstream ENSMUSE00000284126 Chr8:126862343..126862469 CCTTACAGCAGGGAACCAAC Chr8:126862375..126862394 59.59 55

*** Putative Vector Insertion (Chr 8: 126862470 - 126864718) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000284105 Chr8:126864719..126864838 AACGGTCCACCACAGTAAGG Chr8:126864788..126864807 59.88 55
downstream ENSMUSE00000474401 Chr8:126867203..126869618 TCTGGGATACCCGAGATGAG Chr8:126868689..126868708 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000031977