Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11809
Trapped Gene
Dstn (ENSMUSG00000015932)
Vector Insertion
Chr 2: 143765765 - 143767862
Public Clones F042F05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000557614 (Chr2:143765688..143765764 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000557614 (Chr2:143765688..143765764 +)
Downstram Exon
ENSMUSE00000661483 (Chr2:143767863..143769059 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661484 Chr2:143741347..143741383 No primer for this exon
upstream ENSMUSE00000169438 Chr2:143764121..143764428 No primer for this exon
upstream ENSMUSE00000557614 Chr2:143765688..143765764 No primer for this exon

*** Putative Vector Insertion (Chr 2: 143765765 - 143767862) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000661483 Chr2:143767863..143769059 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:143765815..143765835 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCTTTCATGGGTGCAGT Chr2:143765787..143765807 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015932