Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11816
Trapped Gene
Fcho2 (ENSMUSG00000041685)
Vector Insertion
Chr 13: 99495732 - 99496015
Public Clones F015E05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376985 (Chr13:99496016..99496180 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAAAGAAGCGCTTTGCCACT Chr13:99496017..99496036 60.15 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376985 (Chr13:99496016..99496180 -)
Downstram Exon
ENSMUSE00000680159 (Chr13:99493369..99495731 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAAAGAAGCGCTTTGCCACT Chr13:99496017..99496036 60.15 45 CAGAGCTTGTCTGCTTCACG Chr13:99494608..99494627 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680157 Chr13:99585031..99585404 TCTGTACCATTCCTTGCGAAC Chr13:99585314..99585334 60.12 47.62
upstream ENSMUSE00000680188 Chr13:99585031..99585101 No primer for this exon
upstream ENSMUSE00000569531 Chr13:99576261..99576352 No primer for this exon
upstream ENSMUSE00000680187 Chr13:99576261..99576352 No primer for this exon
upstream ENSMUSE00000295736 Chr13:99566248..99566322 ACTAGCGAAATCTGCAAGCAA Chr13:99566263..99566283 60.17 42.86
upstream ENSMUSE00000295735 Chr13:99559687..99559828 GCACCAATGTGGGATGTATTC Chr13:99559801..99559821 60.07 47.62
upstream ENSMUSE00000295733 Chr13:99559318..99559470 AGGCACTCCAGAAGTCGAAG Chr13:99559393..99559412 59.6 55
upstream ENSMUSE00000295729 Chr13:99554731..99554835 No primer for this exon
upstream ENSMUSE00000295725 Chr13:99547344..99547442 ATCGGATCCTTGTCAAATGC Chr13:99547375..99547394 59.9 45
upstream ENSMUSE00000295720 Chr13:99545776..99545872 TTCAGAAATTTGCCGAGTCA Chr13:99545801..99545820 59.4 40
upstream ENSMUSE00000371377 Chr13:99534460..99534504 GACCCTGCTAGTGCAGTTGA Chr13:99534462..99534481 59.04 55
upstream ENSMUSE00000404392 Chr13:99533645..99533717 AGACTTTTGCTTTGCCTGGA Chr13:99533677..99533696 59.99 45
upstream ENSMUSE00000353228 Chr13:99532787..99532811 No primer for this exon
upstream ENSMUSE00000680158 Chr13:99525932..99525942 No primer for this exon
upstream ENSMUSE00000640331 Chr13:99525696..99525807 GTCTCACTGTGCAGCTCTGG Chr13:99525783..99525802 59.76 60
upstream ENSMUSE00000386024 Chr13:99525521..99525580 No primer for this exon
upstream ENSMUSE00000364019 Chr13:99525035..99525208 TGCATCACACAATGGCTTCT Chr13:99525089..99525108 60.27 45
upstream ENSMUSE00000680155 Chr13:99523795..99523803 No primer for this exon
upstream ENSMUSE00000680162 Chr13:99522289..99522300 No primer for this exon
upstream ENSMUSE00000680161 Chr13:99521862..99521886 No primer for this exon
upstream ENSMUSE00000396727 Chr13:99519807..99519849 CAAAGCCGTCTTCTCTACCC Chr13:99519812..99519831 58.93 55
upstream ENSMUSE00000356068 Chr13:99518171..99518259 GGATCGTCGCTTGAGTCATC Chr13:99518200..99518219 60.78 55
upstream ENSMUSE00000358561 Chr13:99515756..99515859 CTTTAGGCACCCTTGTTCCA Chr13:99515819..99515838 60.1 50
upstream ENSMUSE00000295689 Chr13:99513366..99513495 TATCTCCTCGTCTGCCTCGT Chr13:99513393..99513412 59.97 55
upstream ENSMUSE00000295679 Chr13:99504974..99505085 GCAATCGCCCTTACAGAATC Chr13:99505010..99505029 59.67 50
upstream ENSMUSE00000295670 Chr13:99502473..99502628 TCACGGGAGACGTGACAATA Chr13:99502595..99502614 60.11 50
upstream ENSMUSE00000295660 Chr13:99502032..99502164 TTGGATGAACATGCAAGCTG Chr13:99502109..99502128 60.81 45
upstream ENSMUSE00000295651 Chr13:99500732..99500931 TCAAATGGCATTCAGTCCAC Chr13:99500906..99500925 59.5 45
upstream ENSMUSE00000295639 Chr13:99500144..99500208 CGGAGAAATCAGACAGTGGAG Chr13:99500144..99500164 59.85 52.38
upstream ENSMUSE00000376985 Chr13:99496016..99496180 TAAAGAAGCGCTTTGCCACT Chr13:99496017..99496036 60.15 45

*** Putative Vector Insertion (Chr 13: 99495732 - 99496015) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000680159 Chr13:99493369..99495731 CAGAGCTTGTCTGCTTCACG Chr13:99494608..99494627 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAAAGAAGCGCTTTGCCACT Chr13:99496015..99496035 60.15 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAAGAAGCGCTTTGCCACT Chr13:99496015..99496035 60.15 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041685