Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1183
Trapped Gene
Eif1 (ENSMUSG00000035530)
Vector Insertion
Chr 11: 100181475 - 100181979
Public Clones AY0063 (sanger) YTC258 (baygenomics) XB600 (baygenomics) NPX086 (baygenomics)
P131D11 (ggtc) P131D11 (ggtc) P131D11 (ggtc) IST10949C4 (tigm)
Private Clones OST151066 (lexicon) OST137073 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000412034 (Chr11:100181303..100181474 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGTATGTCCGCTATCCAGA Chr11:100181440..100181459 59.25 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000412034 (Chr11:100181303..100181474 +)
Downstram Exon
ENSMUSE00000577257 (Chr11:100181980..100182143 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGTATGTCCGCTATCCAGA Chr11:100181440..100181459 59.25 50 TCCCTTGGACAGTGGTAAGG Chr11:100182099..100182118 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000412034 Chr11:100181303..100181474 TCGTATGTCCGCTATCCAGA Chr11:100181440..100181459 59.25 50

*** Putative Vector Insertion (Chr 11: 100181475 - 100181979) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000577257 Chr11:100181980..100182143 TCCCTTGGACAGTGGTAAGG Chr11:100182099..100182118 59.96 55
downstream ENSMUSE00000577256 Chr11:100182262..100182363 CATATGTTCTTGCGCTGGTC Chr11:100182350..100182369 59.3 50
downstream ENSMUSE00000249225 Chr11:100182631..100183412 AAGGAGCCTCTGGTCAGACA Chr11:100182996..100183015 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTCCACTCTTTCGGTGAG Chr11:100181461..100181481 59.3 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCTCCACTCTTTCGGTGAG Chr11:100181461..100181481 59.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035530