Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11833
Trapped Gene
Rsrc1 (ENSMUSG00000034544)
Vector Insertion
Chr 3: 67094338 - 67153830
Public Clones A068D06 (ggtc) A065B04 (ggtc) IST11213A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639024 (Chr3:67094269..67094337 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGCCAAAGAAAGGAGTGAGG Chr3:67094290..67094310 59.87 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639024 (Chr3:67094269..67094337 +)
Downstram Exon
ENSMUSE00000639023 (Chr3:67153831..67153937 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGCCAAAGAAAGGAGTGAGG Chr3:67094290..67094310 59.87 47.62 TGTTCTACCAGGGTGGCTTG Chr3:67153855..67153874 61.08 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639029 Chr3:66789594..66789728 AAGGCGCTGAGCTTAAATTG Chr3:66789617..66789636 59.63 45
upstream ENSMUSE00000450685 Chr3:66789891..66790011 GCTTGGCCTACAGTGTGGAG Chr3:66789979..66789998 60.85 60
upstream ENSMUSE00000500105 Chr3:66798439..66798634 AGCTTCGCTCGCATTCTTAT Chr3:66798607..66798626 59.23 45
upstream ENSMUSE00000639028 Chr3:66798439..66798634 AGCTTCGCTCGCATTCTTAT Chr3:66798607..66798626 59.23 45
upstream ENSMUSE00000232676 Chr3:66800387..66800512 AAGGTCTCGGTCAAAAAGCA Chr3:66800483..66800502 59.85 45
upstream ENSMUSE00000639027 Chr3:66886458..66886631 GACGTAAAGTCCGGGACAAA Chr3:66886550..66886569 59.97 50
upstream ENSMUSE00000639026 Chr3:66984751..66984787 CTGGAAACATCAAAGCTGGA Chr3:66984756..66984775 58.85 45
upstream ENSMUSE00000639025 Chr3:67010348..67010399 CCAGACTGCAATTGGTCCTT Chr3:67010370..67010389 60.11 50
upstream ENSMUSE00000639024 Chr3:67094269..67094337 AAGCCAAAGAAAGGAGTGAGG Chr3:67094290..67094310 59.87 47.62

*** Putative Vector Insertion (Chr 3: 67094338 - 67153830) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639023 Chr3:67153831..67153937 TGTTCTACCAGGGTGGCTTG Chr3:67153855..67153874 61.08 55
downstream ENSMUSE00000450607 Chr3:67155618..67155674 CCATCATGTCTTCCCAGGAC Chr3:67155640..67155659 60.33 55
downstream ENSMUSE00000639022 Chr3:67159396..67159548 ACATGCTGCACTTCACTTGG Chr3:67159427..67159446 59.9 50
downstream ENSMUSE00000639021 Chr3:67160143..67162325 GTCTCTTTGCTTCCCGACAG Chr3:67161167..67161186 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTAATCGCCTTGCAGCAC Chr3:67151386..67151406 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACAGTCGTGACTGGGAAAAC Chr3:67151383..67151404 60.6 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034544