Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11845
Trapped Gene
Snrp70 (ENSMUSG00000063511)
Vector Insertion
Chr 7: 52650186 - 52650878
Public Clones P108G05 (ggtc) D031E01 (ggtc) P139D12 (ggtc) D034E12 (ggtc) P145D06 (ggtc)
D006H05 (ggtc) D045B06 (ggtc) D034E12 (ggtc) P145D06 (ggtc) D045B06 (ggtc)
CMHD-GT_411F8-3 (cmhd) IST14228H4 (tigm)
Private Clones OST428806 (lexicon) OST313762 (lexicon) OST301977 (lexicon) OST295192 (lexicon)
OST286060 (lexicon) OST194300 (lexicon) OST53443 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000594813 (Chr7:52650879..52651062 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTAACGTCAGGCTGAGGAG Chr7:52650890..52650909 60.16 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000594813 (Chr7:52650879..52651062 -)
Downstram Exon
ENSMUSE00000372078 (Chr7:52650029..52650185 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTAACGTCAGGCTGAGGAG Chr7:52650890..52650909 60.16 60 CTCTCGGATGTATGGTGCAA Chr7:52650013..52650032 59.67 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000594813 Chr7:52650879..52651062 GCTAACGTCAGGCTGAGGAG Chr7:52650890..52650909 60.16 60

*** Putative Vector Insertion (Chr 7: 52650186 - 52650878) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000372078 Chr7:52650029..52650185 CTCTCGGATGTATGGTGCAA Chr7:52650013..52650032 59.67 50
downstream ENSMUSE00000634833 Chr7:52647633..52647695 CTTGTTGGAGGAGGAGCATC Chr7:52647645..52647664 59.8 55
downstream ENSMUSE00000634832 Chr7:52647449..52647503 GTCTCCACTTCCTGCTGTCG Chr7:52647441..52647460 61.01 60
downstream ENSMUSE00000634830 Chr7:52642759..52642823 GCCACGAACAGAGTCTTGAA Chr7:52642744..52642763 59.01 50
downstream ENSMUSE00000634829 Chr7:52642613..52642675 CCTCAAACTCTCTCCGAAGC Chr7:52642611..52642630 59.16 55
downstream ENSMUSE00000531879 Chr7:52639174..52639255 GTGCATGTCTCGTTCATGCT Chr7:52639153..52639172 59.87 50
downstream ENSMUSE00000674409 Chr7:52637195..52638554 GGTGTTGTAAGGGGAGCGTA Chr7:52638483..52638502 59.99 55
downstream ENSMUSE00000531878 Chr7:52636087..52636188 AGGACCCTCCTGCCATCTAT Chr7:52636118..52636137 59.92 55
downstream ENSMUSE00000705788 Chr7:52636087..52636188 AGGACCCTCCTGCCATCTAT Chr7:52636118..52636137 59.92 55
downstream ENSMUSE00000531875 Chr7:52632726..52632813 CCCGAATGCCTGATATTCAC Chr7:52632734..52632753 60.3 50
downstream ENSMUSE00000705787 Chr7:52632726..52632813 CCCGAATGCCTGATATTCAC Chr7:52632734..52632753 60.3 50
downstream ENSMUSE00000461923 Chr7:52631833..52632648 CTTGTCTCGTTCTCGGCTTC Chr7:52632542..52632561 60.13 55
downstream ENSMUSE00000705786 Chr7:52631833..52632648 CTTGTCTCGTTCTCGGCTTC Chr7:52632542..52632561 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTACCTAATCGCCTTGCAG Chr7:52650813..52650833 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGTGAATGAGAGGCCTTA Chr7:52650848..52650868 60.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCGTCTCCACTCCCAGTTCT Chr7:52651055..52651075 59.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCGTCTCCACTCCCAGTTCT Chr7:52651055..52651075 59.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063511