Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11854
Trapped Gene
Tfip11 (ENSMUSG00000029345)
Vector Insertion
Chr 5: 112761041 - 112761983
Public Clones A071A08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000188088 (Chr5:112760888..112761040 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGCCAATGGAGGAAAGAC Chr5:112760904..112760923 60.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000188088 (Chr5:112760888..112761040 +)
Downstram Exon
ENSMUSE00000188099 (Chr5:112761984..112762511 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGCCAATGGAGGAAAGAC Chr5:112760904..112760923 60.19 50 CCAGGCGGTACTCCTCATAA Chr5:112762437..112762456 60.09 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000396433 Chr5:112755384..112755493 No primer for this exon
upstream ENSMUSE00000388930 Chr5:112756505..112756690 TACCGTAGAAGCCGTTCAGG Chr5:112756548..112756567 60.26 55
upstream ENSMUSE00000188098 Chr5:112756982..112757202 CGACTGGGATCTCCAGAATG Chr5:112757074..112757093 60.61 55
upstream ENSMUSE00000188092 Chr5:112758386..112758539 GAGGACTTCCCGAAGGATTT Chr5:112758498..112758517 59.51 50
upstream ENSMUSE00000188097 Chr5:112758767..112758923 GAGACACACGAAAGGGATCG Chr5:112758841..112758860 60.66 55
upstream ENSMUSE00000188089 Chr5:112760111..112760238 TCGGAGAGGACCACTCAGTC Chr5:112760173..112760192 60.4 60
upstream ENSMUSE00000188088 Chr5:112760888..112761040 TGAGCCAATGGAGGAAAGAC Chr5:112760904..112760923 60.19 50

*** Putative Vector Insertion (Chr 5: 112761041 - 112761983) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188099 Chr5:112761984..112762511 CCAGGCGGTACTCCTCATAA Chr5:112762437..112762456 60.09 55
downstream ENSMUSE00000188096 Chr5:112762595..112762701 GTCGTTCTCCAGGAGGCTCT Chr5:112762654..112762673 60.93 60
downstream ENSMUSE00000188095 Chr5:112763337..112763505 CTGTCCAGGAAATCCACCAT Chr5:112763432..112763451 59.78 50
downstream ENSMUSE00000188091 Chr5:112763880..112764123 No primer for this exon
downstream ENSMUSE00000188094 Chr5:112764593..112764735 CCAGTAGAAGGCGTCCATGT Chr5:112764657..112764676 60.13 55
downstream ENSMUSE00000188093 Chr5:112765035..112765200 ATTATGTCGAGCGCTTCGTT Chr5:112765177..112765196 59.87 45
downstream ENSMUSE00000332290 Chr5:112766006..112767089 GGTGTGGCCGATGTCTACTT Chr5:112766378..112766397 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCATCCTCTGAGGGCTTTA Chr5:112761074..112761094 59.77 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCTCACAGCACCTCAGA Chr5:112761002..112761022 59.29 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029345