Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11900
Trapped Gene
Gtf2h3 (ENSMUSG00000029387)
Vector Insertion
Chr 5: 125029211 - 125032456
Public Clones Q021F04 (ggtc) D153B07 (ggtc) FHCRC-GT-S17-3E1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000425687 (Chr5:125029180..125029210 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000425687 (Chr5:125029180..125029210 +)
Downstram Exon
ENSMUSE00000321909 (Chr5:125032457..125032536 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCGGGTTGGTGTCAACTATG Chr5:125032504..125032523 59.42 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000425687 Chr5:125029180..125029210 No primer for this exon

*** Putative Vector Insertion (Chr 5: 125029211 - 125032456) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000321909 Chr5:125032457..125032536 TCGGGTTGGTGTCAACTATG Chr5:125032504..125032523 59.42 50
downstream ENSMUSE00000188456 Chr5:125033943..125034049 TGAATGTGACTGGCGATGAC Chr5:125034046..125034065 60.7 50
downstream ENSMUSE00000188458 Chr5:125034145..125034311 TCACCTCGTTTGCAACTGTC Chr5:125034281..125034300 59.88 50
downstream ENSMUSE00000188450 Chr5:125038634..125038696 GTATGCTGGCCCTTGATGTC Chr5:125038658..125038677 60.49 55
downstream ENSMUSE00000188452 Chr5:125039380..125039409 No primer for this exon
downstream ENSMUSE00000188457 Chr5:125040359..125040387 No primer for this exon
downstream ENSMUSE00000188448 Chr5:125040878..125040952 TCTGAGCAGCAAAGATGACG Chr5:125040950..125040969 60.29 50
downstream ENSMUSE00000188459 Chr5:125042490..125042543 CAGGCGTCGATGAGGATATT Chr5:125042512..125042531 60.06 50
downstream ENSMUSE00000188455 Chr5:125044772..125044840 GGTACAGTCCCCCAGTGATG Chr5:125044802..125044821 60.24 60
downstream ENSMUSE00000188454 Chr5:125045562..125045697 AGACTGCGATGACAGAAGCA Chr5:125045662..125045681 59.73 50
downstream ENSMUSE00000188451 Chr5:125045812..125045848 No primer for this exon
downstream ENSMUSE00000340140 Chr5:125045927..125046849 GACCCAATGCTGGTCATCTT Chr5:125046420..125046439 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTTCCTTGGTTTTCCTTT Chr5:125032189..125032209 59.43 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTTCCTTGGTTTTCCTTT Chr5:125032189..125032209 59.43 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029387