Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1191
Trapped Gene
Csnk1g1 (ENSMUSG00000032384)
Vector Insertion
Chr 9: 65756976 - 65757245
Public Clones CE0461 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000394344 (Chr9:65756817..65756975 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGGGTGGTTGAGAGAAGC Chr9:65756892..65756911 60.63 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000394344 (Chr9:65756817..65756975 +)
Downstram Exon
ENSMUSE00000712627 (Chr9:65757246..65757469 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGGGTGGTTGAGAGAAGC Chr9:65756892..65756911 60.63 55 GGACAATGTGAAGCACAGGA Chr9:65757379..65757398 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394344 Chr9:65756817..65756975 AAGGGGTGGTTGAGAGAAGC Chr9:65756892..65756911 60.63 55

*** Putative Vector Insertion (Chr 9: 65756976 - 65757245) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000712627 Chr9:65757246..65757469 GGACAATGTGAAGCACAGGA Chr9:65757379..65757398 59.68 50
downstream ENSMUSE00000361706 Chr9:65797823..65797871 No primer for this exon
downstream ENSMUSE00000396124 Chr9:65806136..65806528 GAACCCCAGAGGATGTTGAA Chr9:65806462..65806481 59.9 50
downstream ENSMUSE00000714520 Chr9:65806136..65806528 GAACCCCAGAGGATGTTGAA Chr9:65806462..65806481 59.9 50
downstream ENSMUSE00000219277 Chr9:65821286..65821326 No primer for this exon
downstream ENSMUSE00000219276 Chr9:65828710..65828779 AAGTTGTGGAGCACGTGATTT Chr9:65828741..65828761 59.65 42.86
downstream ENSMUSE00000245512 Chr9:65847202..65847353 AACGTTCGGTCACAGAGGTC Chr9:65847319..65847338 60.16 55
downstream ENSMUSE00000219283 Chr9:65849854..65850088 CTTGTCGGCCAATCAAGAAG Chr9:65849938..65849957 60.77 50
downstream ENSMUSE00000584164 Chr9:65855547..65855632 CATATGGCCTAAGGCTTCCA Chr9:65855590..65855609 60.05 50
downstream ENSMUSE00000584163 Chr9:65857870..65857954 CAGAGAGCTTCGATGGGAGT Chr9:65857943..65857962 59.56 55
downstream ENSMUSE00000219275 Chr9:65858229..65858377 ATAGGCCTTCCAACCCAATC Chr9:65858379..65858398 60.15 50
downstream ENSMUSE00000219288 Chr9:65860554..65860661 ATCCCTGTGTGTGTGGCTTT Chr9:65860631..65860650 60.43 50
downstream ENSMUSE00000219284 Chr9:65867609..65867719 CGGCGCTCTGATGATGTAGT Chr9:65867631..65867650 61.37 55
downstream ENSMUSE00000584162 Chr9:65880046..65880152 CATCGACATTCAGCTCTCCA Chr9:65880085..65880104 59.94 50
downstream ENSMUSE00000532529 Chr9:65882857..65882880 No primer for this exon
downstream ENSMUSE00000331733 Chr9:65887384..65892821 TGCAATGTCTCAAGGACAGC Chr9:65890357..65890376 59.99 50
downstream ENSMUSE00000710842 Chr9:65887384..65890882 TGCAATGTCTCAAGGACAGC Chr9:65890357..65890376 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGGGAGACTGGAGTCTGAG Chr9:65757001..65757022 59.56 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGGGAGACTGGAGTCTGAG Chr9:65757001..65757022 59.56 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032384