Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11912
Trapped Gene
Arcn1 (ENSMUSG00000032096)
Vector Insertion
Chr 9: 44558517 - 44559298
Public Clones Q020E02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000216512 (Chr9:44559299..44559446 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGCTTGAAAAACCCAGAG Chr9:44559381..44559400 60.22 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000216512 (Chr9:44559299..44559446 -)
Downstram Exon
ENSMUSE00000216513 (Chr9:44558408..44558516 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGCTTGAAAAACCCAGAG Chr9:44559381..44559400 60.22 45 CACAGCCATTTCCACTTTCC Chr9:44558459..44558478 60.49 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700344 Chr9:44575753..44575896 No primer for this exon
upstream ENSMUSE00000370160 Chr9:44568045..44568308 AAGCGGGAAAGGCTATTGTT Chr9:44568261..44568280 60.1 45
upstream ENSMUSE00000216521 Chr9:44566964..44567143 TATTGCCGAGCCTTAGAGGA Chr9:44567115..44567134 59.94 50
upstream ENSMUSE00000216517 Chr9:44566644..44566849 TTTGGCGGATTTGGTAGTTC Chr9:44566731..44566750 59.94 45
upstream ENSMUSE00000216518 Chr9:44565203..44565367 CAAAGTGCATGCTCCACCTA Chr9:44565216..44565235 59.86 50
upstream ENSMUSE00000216515 Chr9:44560193..44560358 AACCTGTGGGAGAGATGGAG Chr9:44560306..44560325 59.1 55
upstream ENSMUSE00000216512 Chr9:44559299..44559446 TTGGCTTGAAAAACCCAGAG Chr9:44559381..44559400 60.22 45

*** Putative Vector Insertion (Chr 9: 44558517 - 44559298) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000216513 Chr9:44558408..44558516 CACAGCCATTTCCACTTTCC Chr9:44558459..44558478 60.49 50
downstream ENSMUSE00000402776 Chr9:44553501..44553705 GGCACCACTCCAACGTATTT Chr9:44553601..44553620 59.86 50
downstream ENSMUSE00000637376 Chr9:44550224..44552099 CTTCAGCAACTGATCGTCCA Chr9:44550717..44550736 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGACTACAAACAACAGAGGA Chr9:44559317..44559340 58.9 43.48 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAGACTACAAACAACAGAGGA Chr9:44559317..44559340 58.9 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032096