Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11930
Trapped Gene
Senp8 (ENSMUSG00000051705)
Vector Insertion
Chr 9: 59585676 - 59598384
Public Clones E078H03 (ggtc) Q011B02 (ggtc) IST14144E11 (tigm) IST14508H12 (tigm)
IST14317F10 (tigm) IST14846H10 (tigm) IST15047B10 (tigm) IST13601F3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000351344 (Chr9:59598385..59598445 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTTCCGGCCAGTACAGAG Chr9:59598426..59598445 59.35 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000351344 (Chr9:59598385..59598445 -)
Downstram Exon
ENSMUSE00000388347 (Chr9:59582070..59585675 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTTCCGGCCAGTACAGAG Chr9:59598426..59598445 59.35 55 GCTGCTGGTGCACTTAATGA Chr9:59585417..59585436 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000351344 Chr9:59598385..59598445 ACTTTCCGGCCAGTACAGAG Chr9:59598426..59598445 59.35 55

*** Putative Vector Insertion (Chr 9: 59585676 - 59598384) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000388347 Chr9:59582070..59585675 GCTGCTGGTGCACTTAATGA Chr9:59585417..59585436 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAAATAATCGCCTTGCAGCAC Chr9:59595316..59595337 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTAAACGTGACTGGGAAAA Chr9:59595319..59595340 58.61 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGACAGGACAGGGAGAGCAA Chr9:59592419..59592439 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGAAACTTTCATTCCGTGAC Chr9:59592389..59592410 59.96 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051705