Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11946
Trapped Gene
Usp45 (ENSMUSG00000040455)
Vector Insertion
Chr 4: 21703465 - 21707487
Public Clones Q001B07 (ggtc)
Private Clones OST279770 (lexicon) OST261826 (lexicon) OST192838 (lexicon) OST178781 (lexicon)
OST144853 (lexicon) OST52528 (lexicon) OST34673 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000633271 (Chr4:21703419..21703464 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGCTCCTGCGTGTGGAAG Chr4:21703426..21703445 63.4 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000633271 (Chr4:21703419..21703464 +)
Downstram Exon
ENSMUSE00000500199 (Chr4:21707488..21707597 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGCTCCTGCGTGTGGAAG Chr4:21703426..21703445 63.4 60 CAGCAATGTCATCGGAAGAA Chr4:21707600..21707619 59.8 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633271 Chr4:21703419..21703464 GAAGCTCCTGCGTGTGGAAG Chr4:21703426..21703445 63.4 60
upstream ENSMUSE00000471539 Chr4:21703445..21703464 No primer for this exon

*** Putative Vector Insertion (Chr 4: 21703465 - 21707487) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000500199 Chr4:21707488..21707597 CAGCAATGTCATCGGAAGAA Chr4:21707600..21707619 59.8 45
downstream ENSMUSE00000715366 Chr4:21707488..21707597 CAGCAATGTCATCGGAAGAA Chr4:21707600..21707619 59.8 45
downstream ENSMUSE00000240551 Chr4:21708883..21709055 GCTGTCCATCGCAGAATCTT Chr4:21709011..21709030 60.37 50
downstream ENSMUSE00000240539 Chr4:21710030..21710133 GGCTGATGACAACACAATGG Chr4:21710117..21710136 59.97 50
downstream ENSMUSE00000372260 Chr4:21711840..21711940 TTTCTTGTTGCAATGTGTCG Chr4:21711888..21711907 58.32 40
downstream ENSMUSE00000407464 Chr4:21723933..21724075 TCACCTGCTTCACGTTTTTC Chr4:21723987..21724006 58.9 45
downstream ENSMUSE00000240514 Chr4:21724442..21724537 TGTGGAGCTGACGAAAGAGA Chr4:21724536..21724555 59.7 50
downstream ENSMUSE00000240504 Chr4:21725752..21725882 TTTTCAGCCTCCTTCATGCT Chr4:21725840..21725859 59.96 45
downstream ENSMUSE00000331742 Chr4:21731373..21731460 CACTGCATCCAACAGATGGT Chr4:21731445..21731464 59.55 50
downstream ENSMUSE00000240486 Chr4:21737889..21737970 TTGGGTTGTTGAAGGCTTTT Chr4:21737931..21737950 59.59 40
downstream ENSMUSE00000370083 Chr4:21742454..21742545 CGCACATTCTTCACACATGAC Chr4:21742544..21742564 60.18 47.62
downstream ENSMUSE00000239840 Chr4:21744029..21744085 No primer for this exon
downstream ENSMUSE00000336379 Chr4:21744648..21744791 AGTCACGGTGCCCTTGTTAT Chr4:21744737..21744756 59.48 50
downstream ENSMUSE00000239823 Chr4:21751564..21752224 GCCAGTTACAGTGCCACTCA Chr4:21751962..21751981 59.9 55
downstream ENSMUSE00000333601 Chr4:21753301..21753398 AGGAACGGCAGATATGAGGA Chr4:21753365..21753384 59.65 50
downstream ENSMUSE00000240441 Chr4:21757564..21757650 GTGCCAAGTCAAGGGTAAGC Chr4:21757630..21757649 59.74 55
downstream ENSMUSE00000240435 Chr4:21759311..21759464 GTAGTGGCCTCCTCTCATGG Chr4:21759394..21759413 59.68 60
downstream ENSMUSE00000468825 Chr4:21761382..21765019 AAATTTGATGTGCGGTGACA Chr4:21764587..21764606 59.97 40
downstream ENSMUSE00000474738 Chr4:21761382..21761718 ATAACGCTGGAAGGATGCAC Chr4:21761624..21761643 60.1 50
downstream ENSMUSE00000469757 Chr4:21763721..21765018 AAATTTGATGTGCGGTGACA Chr4:21764587..21764606 59.97 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTTCGCTTAATCGCCTTG Chr4:21706507..21706527 59.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCACTGTGTCTTCGCTCGT Chr4:21706499..21706519 60.93 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040455