Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11947
Trapped Gene
Bop1 (ENSMUSG00000022557)
Vector Insertion
Chr 15: 76307558 - 76307652
Public Clones Q001A08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648331 (Chr15:76307619..76307651 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648331 (Chr15:76307619..76307651 -)
Downstram Exon
ENSMUSE00000499525 (Chr15:76307559..76307682 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000648331 Chr15:76307619..76307651 No primer for this exon
upstream ENSMUSE00000499525 Chr15:76307559..76307682 AACGACGTTTGGAACCTGAT Chr15:76307580..76307599 59.45 45
upstream ENSMUSE00000648330 Chr15:76307559..76307617 AACGACGTTTGGAACCTGAT Chr15:76307580..76307599 59.45 45

*** Putative Vector Insertion (Chr 15: 76307558 - 76307652) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648329 Chr15:76305195..76305351 GAGTCAGGATCGCTGAGGAG Chr15:76305304..76305323 60.1 60
downstream ENSMUSE00000500270 Chr15:76305178..76305351 GAGTCAGGATCGCTGAGGAG Chr15:76305304..76305323 60.1 60
downstream ENSMUSE00000648328 Chr15:76305178..76305192 No primer for this exon
downstream ENSMUSE00000505107 Chr15:76297202..76297282 TATTCATCTTGGGCCAGAGC Chr15:76297205..76297224 60.18 50
downstream ENSMUSE00000128304 Chr15:76286302..76286456 GATACGTTTGCCATCCAGGT Chr15:76286348..76286367 59.82 50
downstream ENSMUSE00000128303 Chr15:76286112..76286229 CATCAGTTAGCCGCAGATCA Chr15:76286158..76286177 59.97 50
downstream ENSMUSE00000128308 Chr15:76285926..76286027 ATGATGTCACCGCTGAAGAA Chr15:76285974..76285993 59.24 45
downstream ENSMUSE00000128309 Chr15:76285638..76285850 TACTCGGGAGGTGGGTTGTA Chr15:76285635..76285654 60.37 55
downstream ENSMUSE00000128305 Chr15:76285400..76285561 CCTCAAGCTGGGGAATTTCT Chr15:76285465..76285484 60.57 50
downstream ENSMUSE00000242941 Chr15:76285248..76285328 GGGAAAGGCTGAAGGTCTCT Chr15:76285242..76285261 59.82 55
downstream ENSMUSE00000242932 Chr15:76285104..76285173 No primer for this exon
downstream ENSMUSE00000242922 Chr15:76284882..76285014 GCAGCTACCAGGCATATGGT Chr15:76284866..76284885 60.12 55
downstream ENSMUSE00000242910 Chr15:76284608..76284788 GCTCCTCAGGTGGAGTGAAG Chr15:76284669..76284688 59.99 60
downstream ENSMUSE00000242902 Chr15:76284247..76284535 CACTTGCGTGTGCTCTTGAC Chr15:76284436..76284455 60.66 55
downstream ENSMUSE00000242897 Chr15:76284074..76284158 GGTGGAAAGATCCAGGTCAA Chr15:76284072..76284091 59.9 50
downstream ENSMUSE00000482703 Chr15:76283893..76284000 TAACACTGCCGTCGTCTGAG Chr15:76283896..76283915 60.05 55
downstream ENSMUSE00000481852 Chr15:76283572..76283808 GGTGTGTCCTTTCAGCACCT Chr15:76283732..76283751 60.16 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCGGCAGTAGATCGGTA Chr15:76307666..76307686 60.37 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCGGCAGTAGATCGGTA Chr15:76307666..76307686 60.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022557