Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11948
Trapped Gene
Banf1 (ENSMUSG00000024844)
Vector Insertion
Chr 19: 5365159 - 5365817
Public Clones (sanger) D077H06 (ggtc) D056C05 (ggtc) Q001C01 (ggtc) D077G04 (ggtc)
D056C05 (ggtc) D077H06 (ggtc) D070H08 (ggtc) CMHD-GT_466C7-3 (cmhd) CMHD-GT_381H9-3 (cmhd)
CMHD-GT_146C10-3 (cmhd) CMHD-GT_417C9-3 (cmhd) CMHD-GT_473C1-3 (cmhd) CMHD-GT_393A2-3 (cmhd)
CMHD-GT_471H2-3 (cmhd) CMHD-GT_331D8-3 (cmhd) CMHD-GT_434C6-3 (cmhd) CMHD-GT_543H9-3 (cmhd)
PST17990-NR (escells) PST10308-NR (escells) PST3682-NR (escells) PSTVUpb16f7 (vanderbilt)
IST13643B10 (tigm) IST10730A9 (tigm) IST14519H1 (tigm) IST12151A12 (tigm)
Private Clones OST425768 (lexicon) OST389402 (lexicon) OST385877 (lexicon) OST364960 (lexicon)
OST338506 (lexicon) OST336470 (lexicon) OST267159 (lexicon) OST262895 (lexicon)
OST256023 (lexicon) OST237797 (lexicon) OST232726 (lexicon) OST224442 (lexicon)
OST204759 (lexicon) OST185854 (lexicon) OST183968 (lexicon) OST171086 (lexicon)
OST138511 (lexicon) OST102324 (lexicon) OST81681 (lexicon) OST81160 (lexicon)
OST26453 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000145472 (Chr19:5365818..5365956 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAAAGCACCGAGACTTCGT Chr19:5365909..5365928 60.43 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000145472 (Chr19:5365818..5365956 -)
Downstram Exon
ENSMUSE00000413957 (Chr19:5364641..5365158 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAAAGCACCGAGACTTCGT Chr19:5365909..5365928 60.43 50 AGGGGAGAGAACTCCCCATA Chr19:5364837..5364856 59.89 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000384820 Chr19:5366568..5366631 No primer for this exon
upstream ENSMUSE00000145472 Chr19:5365818..5365956 CAAAAGCACCGAGACTTCGT Chr19:5365909..5365928 60.43 50

*** Putative Vector Insertion (Chr 19: 5365159 - 5365817) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000413957 Chr19:5364641..5365158 AGGGGAGAGAACTCCCCATA Chr19:5364837..5364856 59.89 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAAGGGGCTTTGACAAGGT Chr19:5365814..5365834 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAGGGGCTTTGACAAGGT Chr19:5365814..5365834 60.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACTTCGTGTAATCGCCTTGC Chr19:5365894..5365914 60.28 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAAAAGCACCGAGACTTCGT Chr19:5365907..5365927 60.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024844