Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11950
Trapped Gene
Nde1 (ENSMUSG00000022678)
Vector Insertion
Chr 16: 14163462 - 14169544
Public Clones (sanger) P015E10 (ggtc) PST4312-NR (escells) IST14198B4 (tigm) IST14730C11 (tigm)
IST10987B11 (tigm)
Private Clones OST427648 (lexicon) OST416144 (lexicon) OST292411 (lexicon) OST261109 (lexicon)
OST260479 (lexicon) OST235322 (lexicon) OST189927 (lexicon) OST134680 (lexicon)
OST130694 (lexicon) OST106438 (lexicon) OST32210 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000396125 (Chr16:14163399..14163461 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000396125 (Chr16:14163399..14163461 +)
Downstram Exon
ENSMUSE00000360932 (Chr16:14169545..14169668 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCGAGTCCTCCATGGTAAAA Chr16:14169601..14169620 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710851 Chr16:14163380..14163461 No primer for this exon
upstream ENSMUSE00000396125 Chr16:14163399..14163461 No primer for this exon

*** Putative Vector Insertion (Chr 16: 14163462 - 14169544) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000360932 Chr16:14169545..14169668 CCGAGTCCTCCATGGTAAAA Chr16:14169601..14169620 59.93 50
downstream ENSMUSE00000710553 Chr16:14169545..14169668 CCGAGTCCTCCATGGTAAAA Chr16:14169601..14169620 59.93 50
downstream ENSMUSE00000704198 Chr16:14169568..14169668 CCGAGTCCTCCATGGTAAAA Chr16:14169601..14169620 59.93 50
downstream ENSMUSE00000563156 Chr16:14170431..14170584 CGAAGGCGGTTATTCTCTGA Chr16:14170565..14170584 60.34 50
downstream ENSMUSE00000704197 Chr16:14170431..14170584 CGAAGGCGGTTATTCTCTGA Chr16:14170565..14170584 60.34 50
downstream ENSMUSE00000129431 Chr16:14175384..14175532 AGATCTGCCGGTAACCCTCT Chr16:14175429..14175448 60.1 55
downstream ENSMUSE00000563152 Chr16:14183569..14183705 CTTGATTCAAACGCTGCTCA Chr16:14183618..14183637 60.13 45
downstream ENSMUSE00000704196 Chr16:14183569..14183705 CTTGATTCAAACGCTGCTCA Chr16:14183618..14183637 60.13 45
downstream ENSMUSE00000129434 Chr16:14185787..14185966 AGACGGTACAGAGCCTGTGG Chr16:14185908..14185927 60.32 60
downstream ENSMUSE00000129433 Chr16:14188406..14188497 CAGGTCCCCAACGATGTTTA Chr16:14188485..14188504 60.74 50
downstream ENSMUSE00000129429 Chr16:14190180..14190325 TTTTGGTTCCTCGTCCTGAG Chr16:14190276..14190295 60.22 50
downstream ENSMUSE00000704199 Chr16:14191683..14191695 No primer for this exon
downstream ENSMUSE00000388059 Chr16:14191811..14192921 ACCACCCTGGTTGCTCTATG Chr16:14192582..14192601 59.99 55
downstream ENSMUSE00000704195 Chr16:14191811..14192659 ACCACCCTGGTTGCTCTATG Chr16:14192582..14192601 59.99 55
downstream ENSMUSE00000717321 Chr16:14192435..14192921 CCCTGGTTGCTCTATGGTGT Chr16:14192578..14192597 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCATCCATAATCGCCTTG Chr16:14163504..14163524 61.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACGTGACTGGGAAAACC Chr16:14163509..14163529 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022678