Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11951
Trapped Gene
Cpsf6 (ENSMUSG00000055531)
Vector Insertion
Chr 10: 116803241 - 116804834
Public Clones Q003F04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000459168 (Chr10:116804835..116805044 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGGAAGAGAATCGCATTG Chr10:116804856..116804875 60.73 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000459168 (Chr10:116804835..116805044 -)
Downstram Exon
ENSMUSE00000459152 (Chr10:116803137..116803240 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGGAAGAGAATCGCATTG Chr10:116804856..116804875 60.73 50 CATTTGCCCGATTTTCAAAG Chr10:116803128..116803147 60.43 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000573809 Chr10:116813895..116814029 AGACATTTACGCGGATGTGG Chr10:116813912..116813931 60.91 50
upstream ENSMUSE00000459168 Chr10:116804835..116805044 CTGGGAAGAGAATCGCATTG Chr10:116804856..116804875 60.73 50

*** Putative Vector Insertion (Chr 10: 116803241 - 116804834) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000459152 Chr10:116803137..116803240 CATTTGCCCGATTTTCAAAG Chr10:116803128..116803147 60.43 40
downstream ENSMUSE00000459150 Chr10:116800031..116800176 TGCTTCAGATCCAACACCAA Chr10:116800124..116800143 60.24 45
downstream ENSMUSE00000459143 Chr10:116799070..116799243 AGGAAATCTGTCCCCACCAG Chr10:116799088..116799107 61.28 55
downstream ENSMUSE00000459138 Chr10:116797912..116798416 GGGACCGTAGTCACCCCTAT Chr10:116797898..116797917 60.07 60
downstream ENSMUSE00000459134 Chr10:116797496..116797611 GCACTAGCGTCAGACACAGC Chr10:116797476..116797495 59.81 60
downstream ENSMUSE00000459129 Chr10:116796049..116796202 CCAGACCCATAGGACTTGGA Chr10:116796033..116796052 59.92 55
downstream ENSMUSE00000459161 Chr10:116792994..116793180 TATGGCGACGACTCTTTTCC Chr10:116793100..116793119 60.21 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGAAGAGAATCGCATTGTA Chr10:116804852..116804873 60.59 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCATCGTGACTGGGAAAAC Chr10:116804768..116804789 59.05 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055531