Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11958
Trapped Gene
Cenpf (ENSMUSG00000026605)
Vector Insertion
Chr 1: 191483952 - 191485875
Public Clones A042D07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000360638 (Chr1:191485876..191486011 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGTCTGAGCAGAGGACCA Chr1:191485960..191485979 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000360638 (Chr1:191485876..191486011 -)
Downstram Exon
ENSMUSE00000432761 (Chr1:191483190..191483951 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGTCTGAGCAGAGGACCA Chr1:191485960..191485979 59.69 55 CGCAAGTCTTGGTACTGCTG Chr1:191483245..191483264 59.66 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000432810 Chr1:191511855..191511965 GAGCCAGGTTCTGTGAGGAG Chr1:191511860..191511879 59.99 60
upstream ENSMUSE00000336714 Chr1:191508824..191509017 AGCTTGAAGGACAGCTGGAG Chr1:191508902..191508921 59.74 55
upstream ENSMUSE00000374126 Chr1:191507647..191507843 CTGAGCTCATGCAAAAAGCA Chr1:191507677..191507696 60.28 45
upstream ENSMUSE00000333698 Chr1:191506709..191506830 AGAAGCCAACAAGTTGCACA Chr1:191506792..191506811 59.49 45
upstream ENSMUSE00000412799 Chr1:191506240..191506331 No primer for this exon
upstream ENSMUSE00000372309 Chr1:191504100..191504385 GCTCTGAAAACCCCACTGAG Chr1:191504246..191504265 59.84 55
upstream ENSMUSE00000410181 Chr1:191502818..191503020 GCTGGAGAAGACGAAAGTGG Chr1:191502904..191502923 59.99 55
upstream ENSMUSE00000341784 Chr1:191496388..191496513 ACCGACAGAACGCAGAGAGT Chr1:191496442..191496461 60.06 55
upstream ENSMUSE00000389189 Chr1:191494927..191495055 GTCCCGACAGCATCAATCTT Chr1:191495031..191495050 60.08 50
upstream ENSMUSE00000398942 Chr1:191492395..191492517 AAACGAGCTGAGGAGAAGCA Chr1:191492400..191492419 60.28 50
upstream ENSMUSE00000360638 Chr1:191485876..191486011 TCAGTCTGAGCAGAGGACCA Chr1:191485960..191485979 59.69 55

*** Putative Vector Insertion (Chr 1: 191483952 - 191485875) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000432761 Chr1:191483190..191483951 CGCAAGTCTTGGTACTGCTG Chr1:191483245..191483264 59.66 55
downstream ENSMUSE00000160935 Chr1:191480524..191483147 CTCGGACCTCTTTGCTTGAC Chr1:191481278..191481297 59.99 55
downstream ENSMUSE00000289743 Chr1:191476140..191478971 CTCAAGGAAGAGCACCGTTC Chr1:191477229..191477248 59.99 55
downstream ENSMUSE00000160936 Chr1:191475027..191475179 GTCTTCGCTCAGCTGTGTTG Chr1:191475074..191475093 59.78 55
downstream ENSMUSE00000160937 Chr1:191474441..191474600 GCACGCTGAAGTTCCTTCTC Chr1:191474529..191474548 60.14 55
downstream ENSMUSE00000160938 Chr1:191472490..191472966 GACTTCAGCCGAGCAACTTC Chr1:191472761..191472780 60.14 55
downstream ENSMUSE00000160940 Chr1:191470681..191470859 AGTTGGGATGTCAGCAAACC Chr1:191470818..191470837 59.97 50
downstream ENSMUSE00000390024 Chr1:191464495..191466681 TTCCAACAGTGAAACCACCA Chr1:191465346..191465365 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCCAGAATTTTGCAGAAGA Chr1:191485882..191485903 59.58 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCCAGAATTTTGCAGAAGA Chr1:191485882..191485903 59.58 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026605