Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1197
Trapped Gene
Pkn2 (ENSMUSG00000004591)
Vector Insertion
Chr 3: 142475022 - 142483500
Public Clones CE0149 (sanger) RRF388 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000586383 (Chr3:142483501..142483610 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000586383 (Chr3:142483501..142483610 -)
Downstram Exon
ENSMUSE00000586382 (Chr3:142474878..142475021 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669079 Chr3:142516843..142516848 No primer for this exon
upstream ENSMUSE00000669063 Chr3:142516628..142516678 No primer for this exon
upstream ENSMUSE00000586376 Chr3:142516378..142516597 No primer for this exon
upstream ENSMUSE00000586389 Chr3:142516378..142516678 No primer for this exon
upstream ENSMUSE00000586388 Chr3:142502172..142502326 No primer for this exon
upstream ENSMUSE00000586387 Chr3:142493461..142493578 No primer for this exon
upstream ENSMUSE00000586386 Chr3:142492148..142492293 No primer for this exon
upstream ENSMUSE00000586385 Chr3:142491845..142492058 No primer for this exon
upstream ENSMUSE00000586384 Chr3:142484483..142484668 No primer for this exon
upstream ENSMUSE00000586383 Chr3:142483501..142483610 No primer for this exon

*** Putative Vector Insertion (Chr 3: 142475022 - 142483500) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000586382 Chr3:142474878..142475021 No primer for this exon
downstream ENSMUSE00000586381 Chr3:142474491..142474566 No primer for this exon
downstream ENSMUSE00000586380 Chr3:142473655..142473829 No primer for this exon
downstream ENSMUSE00000586366 Chr3:142473325..142473451 No primer for this exon
downstream ENSMUSE00000586365 Chr3:142472788..142472918 No primer for this exon
downstream ENSMUSE00000586378 Chr3:142472606..142472681 No primer for this exon
downstream ENSMUSE00000586377 Chr3:142472437..142472528 No primer for this exon
downstream ENSMUSE00000271205 Chr3:142466518..142466694 No primer for this exon
downstream ENSMUSE00000177758 Chr3:142464004..142464066 No primer for this exon
downstream ENSMUSE00000177756 Chr3:142462769..142462845 No primer for this exon
downstream ENSMUSE00000177755 Chr3:142461867..142462009 No primer for this exon
downstream ENSMUSE00000177759 Chr3:142457352..142457459 No primer for this exon
downstream ENSMUSE00000177760 Chr3:142457067..142457147 No primer for this exon
downstream ENSMUSE00000561979 Chr3:142456266..142456978 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTCGTGGGACCAGAAGTT Chr3:142477518..142477538 60.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTCGTGGGACCAGAAGTT Chr3:142477518..142477538 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004591