Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11973
Trapped Gene
Dnaja2 (ENSMUSG00000031701)
Vector Insertion
Chr 8: 88072862 - 88077085
Public Clones P012G02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212047 (Chr8:88077086..88077309 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTTTATGGGCAATCAGAG Chr8:88077137..88077156 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212047 (Chr8:88077086..88077309 -)
Downstram Exon
ENSMUSE00000212044 (Chr8:88072781..88072861 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTTTATGGGCAATCAGAG Chr8:88077137..88077156 59.67 50 TTTGGTTGTCTTGCCATTGT Chr8:88072800..88072819 59.02 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000400893 Chr8:88079069..88079237 CGAAGCTGTACGACATCCTG Chr8:88079108..88079127 59.47 55
upstream ENSMUSE00000212042 Chr8:88077816..88077875 GCCAAAGAATACCACCCTGA Chr8:88077841..88077860 59.93 50
upstream ENSMUSE00000212047 Chr8:88077086..88077309 GGCTTTATGGGCAATCAGAG Chr8:88077137..88077156 59.67 50

*** Putative Vector Insertion (Chr 8: 88072862 - 88077085) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212044 Chr8:88072781..88072861 TTTGGTTGTCTTGCCATTGT Chr8:88072800..88072819 59.02 40
downstream ENSMUSE00000212041 Chr8:88072463..88072596 CTGATCATAATGCGCACACC Chr8:88072503..88072522 60.1 50
downstream ENSMUSE00000212040 Chr8:88070412..88070608 TTCCCCAGTGAACGTAATCC Chr8:88070456..88070475 59.79 50
downstream ENSMUSE00000212039 Chr8:88064207..88064351 CACCACAATCTGACGAGCAT Chr8:88064216..88064235 59.71 50
downstream ENSMUSE00000212046 Chr8:88063949..88064076 TCACCTCGAACAACACGAAC Chr8:88064030..88064049 59.73 50
downstream ENSMUSE00000212043 Chr8:88062531..88063306 CAAACCCATTGTGTGCAAAG Chr8:88062629..88062648 60 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAAATGGCAGAAGAAGAGG Chr8:88074108..88074128 59.95 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAAATGGCAGAAGAAGAGG Chr8:88074108..88074128 59.95 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031701