Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11974
Trapped Gene
Fxr1 (ENSMUSG00000027680)
Vector Insertion
Chr 3: 33938502 - 33939984
Public Clones M008E02 (ggtc) D054F11 (ggtc) D107A09 (ggtc) P013G10 (ggtc) D054F11 (ggtc)
Private Clones OST464221 (lexicon) OST446424 (lexicon) OST432497 (lexicon) OST415114 (lexicon)
OST383680 (lexicon) OST379341 (lexicon) OST373637 (lexicon) OST364232 (lexicon)
OST362155 (lexicon) OST354315 (lexicon) OST331143 (lexicon) OST328695 (lexicon)
OST299432 (lexicon) OST297004 (lexicon) OST262974 (lexicon) OST234584 (lexicon)
OST232867 (lexicon) OST230567 (lexicon) OST209867 (lexicon) OST205252 (lexicon)
OST196381 (lexicon) OST195215 (lexicon) OST112089 (lexicon) OST65798 (lexicon)
OST37573 (lexicon) OST36299 (lexicon) OST36026 (lexicon) OST35429 (lexicon)
OST35280 (lexicon) OST34775 (lexicon) OST34746 (lexicon) OST34726 (lexicon)
OST34704 (lexicon) OST34698 (lexicon) OST34688 (lexicon) OST34683 (lexicon)
OST34677 (lexicon) OST34671 (lexicon) OST34654 (lexicon) OST34651 (lexicon)
OST34649 (lexicon) OST34648 (lexicon) OST34627 (lexicon) OST34625 (lexicon)
OST34590 (lexicon) OST34266 (lexicon) OST34265 (lexicon) OST34241 (lexicon)
OST33603 (lexicon) OST33229 (lexicon) OST33199 (lexicon) OST33180 (lexicon)
OST33148 (lexicon) OST33133 (lexicon) OST32478 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000450747 (Chr3:33938449..33938501 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCACGAAGACTCCCTCAC Chr3:33938464..33938483 59.69 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000450747 (Chr3:33938449..33938501 +)
Downstram Exon
ENSMUSE00000639573 (Chr3:33939985..33940078 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCACGAAGACTCCCTCAC Chr3:33938464..33938483 59.69 60 GGTGGTGGTAATCGCACTTC Chr3:33940038..33940057 60.38 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000489359 Chr3:33919030..33919085 No primer for this exon
upstream ENSMUSE00000450747 Chr3:33938449..33938501 GTCCACGAAGACTCCCTCAC Chr3:33938464..33938483 59.69 60

*** Putative Vector Insertion (Chr 3: 33938502 - 33939984) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639573 Chr3:33939985..33940078 GGTGGTGGTAATCGCACTTC Chr3:33940038..33940057 60.38 55
downstream ENSMUSE00000639572 Chr3:33944954..33945025 GCCTTTCATCATCCGAACTT Chr3:33945025..33945044 59.13 45
downstream ENSMUSE00000639571 Chr3:33945359..33945507 TTTGATTGACAGGCCGAAGT Chr3:33945443..33945462 60.64 45
downstream ENSMUSE00000639570 Chr3:33945888..33945981 TGCATGCTCCTACTGCTTTC Chr3:33945943..33945962 59.18 50
downstream ENSMUSE00000639569 Chr3:33946554..33946670 GGCCTCTTCATTTCTGGACA Chr3:33946658..33946677 60.19 50
downstream ENSMUSE00000639568 Chr3:33948075..33948245 AACGTTCCGGTGTCTTCATC Chr3:33948232..33948251 59.97 50
downstream ENSMUSE00000639567 Chr3:33948997..33949075 No primer for this exon
downstream ENSMUSE00000639566 Chr3:33953144..33953253 TTCTTACTCGAACCACACCAGA Chr3:33953216..33953237 59.77 45.46
downstream ENSMUSE00000639564 Chr3:33955252..33955338 GCACATTCCCAATGCTTTCT Chr3:33955306..33955325 60.08 45
downstream ENSMUSE00000172139 Chr3:33956946..33957153 CATCAATCTGCAGACGTTCC Chr3:33956988..33957007 59.24 50
downstream ENSMUSE00000520260 Chr3:33956946..33957003 CATCAATCTGCAGACGTTCC Chr3:33956988..33957007 59.24 50
downstream ENSMUSE00000515423 Chr3:33957091..33957153 ACGACCTCTGCCTCTTCCAC Chr3:33957128..33957147 61.78 60
downstream ENSMUSE00000639563 Chr3:33960750..33960953 TGTCTCGCTGATGTCGAGTC Chr3:33960866..33960885 60.15 55
downstream ENSMUSE00000592734 Chr3:33963041..33963245 ACCGCCTACGACGGTTAGTA Chr3:33963157..33963176 59.65 55
downstream ENSMUSE00000592745 Chr3:33963041..33963241 ACCGCCTACGACGGTTAGTA Chr3:33963157..33963176 59.65 55
downstream ENSMUSE00000172137 Chr3:33963896..33963976 GGCTGTCTATCTTCTGCCTGA Chr3:33963976..33963996 59.59 52.38
downstream ENSMUSE00000675906 Chr3:33965422..33965431 No primer for this exon
downstream ENSMUSE00000172144 Chr3:33967083..33967174 TGGGAGGTTTCTTTGTCTGC Chr3:33967144..33967163 60.23 50
downstream ENSMUSE00000514715 Chr3:33967839..33968259 CCTTTTCTGAAGGACCATGC Chr3:33967881..33967900 59.67 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACGAAGACTCCCTCACAG Chr3:33938467..33938487 60.85 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACGAAGACTCCCTCACAG Chr3:33938467..33938487 60.85 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027680