Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11980
Trapped Gene
Psmd14 (ENSMUSG00000026914)
Vector Insertion
Chr 2: 61549931 - 61558500
Public Clones (sanger) P015E07 (ggtc)
Private Clones OST453085 (lexicon) OST377878 (lexicon) OST60243 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164032 (Chr2:61549816..61549930 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGATTCATCGCCTGTTCT Chr2:61549849..61549868 60.37 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164032 (Chr2:61549816..61549930 +)
Downstram Exon
ENSMUSE00000164024 (Chr2:61558501..61558628 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGATTCATCGCCTGTTCT Chr2:61549849..61549868 60.37 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000164032 Chr2:61549816..61549930 GCTGATTCATCGCCTGTTCT Chr2:61549849..61549868 60.37 50

*** Putative Vector Insertion (Chr 2: 61549931 - 61558500) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000164024 Chr2:61558501..61558628 No primer for this exon
downstream ENSMUSE00000386329 Chr2:61560767..61560818 CAGTCCAGGCATACCTCCTC Chr2:61560815..61560834 59.68 60
downstream ENSMUSE00000350608 Chr2:61598693..61598764 TTTAGCAAGGCCAAGGAAGA Chr2:61598766..61598785 59.95 45
downstream ENSMUSE00000164026 Chr2:61599032..61599151 TCCAGCACGACCATGTTTTA Chr2:61599058..61599077 60.11 45
downstream ENSMUSE00000164029 Chr2:61601894..61601964 CCAACATTTTGGCTTGGAAC Chr2:61601945..61601964 60.34 45
downstream ENSMUSE00000164030 Chr2:61602906..61603056 GAATGGGATCCACAACCACT Chr2:61603042..61603061 59.64 50
downstream ENSMUSE00000164022 Chr2:61614730..61614837 GCTTGTTTAAGTGGCCCAGA Chr2:61614829..61614848 60.25 50
downstream ENSMUSE00000164034 Chr2:61621890..61621964 No primer for this exon
downstream ENSMUSE00000164018 Chr2:61623491..61623616 CCTGAAGTGTCAATCCTTCCA Chr2:61623544..61623564 60.1 47.62
downstream ENSMUSE00000164020 Chr2:61635452..61635514 CCAGCTGTTCAGGTGTCATC Chr2:61635494..61635513 59.26 55
downstream ENSMUSE00000341036 Chr2:61638039..61638432 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTAATCGCCTTGCAGCAC Chr2:61555979..61555999 62.6 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGACCGCGAGCTCTCTTCAG Chr2:61555941..61555961 62.31 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026914