Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11989
Trapped Gene
Aldh2 (ENSMUSG00000029455)
Vector Insertion
Chr 5: 122029754 - 122030622
Public Clones G065E05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189032 (Chr5:122030623..122030727 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAAACATTTCCCACCGTCA Chr5:122030670..122030689 60.73 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189032 (Chr5:122030623..122030727 -)
Downstram Exon
ENSMUSE00000189035 (Chr5:122029613..122029753 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAAACATTTCCCACCGTCA Chr5:122030670..122030689 60.73 45 GTTCAATGAGATCCGCCAAT Chr5:122029611..122029630 59.9 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000355577 Chr5:122043371..122043599 CTCGCCCATTTCAGTTCAGT Chr5:122043521..122043540 60.26 50
upstream ENSMUSE00000189032 Chr5:122030623..122030727 GAAAACATTTCCCACCGTCA Chr5:122030670..122030689 60.73 45

*** Putative Vector Insertion (Chr 5: 122029754 - 122030622) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000189035 Chr5:122029613..122029753 GTTCAATGAGATCCGCCAAT Chr5:122029611..122029630 59.9 45
downstream ENSMUSE00000189034 Chr5:122028352..122028431 CCACCAGGTACGAGATGACA Chr5:122028358..122028377 59.54 55
downstream ENSMUSE00000189023 Chr5:122026466..122026577 CATGGCGGGTATAGCTGAAG Chr5:122026476..122026495 60.62 55
downstream ENSMUSE00000189024 Chr5:122025905..122026033 TTGATCAAGTTGGCCACGTA Chr5:122025887..122025906 60.11 45
downstream ENSMUSE00000189031 Chr5:122025100..122025213 GAATCCGGGAACGATATTGA Chr5:122025150..122025169 59.72 45
downstream ENSMUSE00000189030 Chr5:122023432..122023534 CCACCTGGATTAGGTGACCA Chr5:122023491..122023510 60.77 55
downstream ENSMUSE00000538240 Chr5:122022685..122022869 CATTCTCCTGCACGAAGGTC Chr5:122022755..122022774 60.8 55
downstream ENSMUSE00000189028 Chr5:122022026..122022190 GTCTTTTACGTCCCCGAACA Chr5:122022028..122022047 59.97 50
downstream ENSMUSE00000189029 Chr5:122020613..122020770 AACCTCCTCGATGGTCTTGA Chr5:122020698..122020717 59.65 50
downstream ENSMUSE00000189025 Chr5:122018935..122019049 CTGCCACTCCCTGACATCTT Chr5:122018959..122018978 60.26 55
downstream ENSMUSE00000649993 Chr5:122017718..122018032 GTGTGGCGGTTTTTCTCAGT Chr5:122017909..122017928 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCGAAGGGAACAAGGTAAG Chr5:122030616..122030636 60.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCGAAGGGAACAAGGTAAG Chr5:122030616..122030636 60.98 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029455