Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11998
Trapped Gene
C1qbp (ENSMUSG00000018446)
Vector Insertion
Chr 11: 70793606 - 70795671
Public Clones G058D06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000318037 (Chr11:70795672..70795822 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000318037 (Chr11:70795672..70795822 -)
Downstram Exon
ENSMUSE00000109520 (Chr11:70793512..70793605 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485352 Chr11:70796227..70796467 No primer for this exon
upstream ENSMUSE00000318037 Chr11:70795672..70795822 No primer for this exon

*** Putative Vector Insertion (Chr 11: 70793606 - 70795671) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000109520 Chr11:70793512..70793605 No primer for this exon
downstream ENSMUSE00000109524 Chr11:70792191..70792286 No primer for this exon
downstream ENSMUSE00000109522 Chr11:70791930..70792052 No primer for this exon
downstream ENSMUSE00000318026 Chr11:70791360..70791746 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGTCGGGAATCCCTGATA Chr11:70795618..70795638 59.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCGGAGAAAAGTAAGTGG Chr11:70795662..70795682 60.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018446