Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI120
Trapped Gene
Aqr (ENSMUSG00000040383)
Vector Insertion
Chr 2: 113960556 - 113962605
Public Clones GC0053 (tigem) W078A08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661883 (Chr2:113962606..113962784 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAACCCAACATCGGTGAAAA Chr2:113962680..113962699 60.21 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661883 (Chr2:113962606..113962784 -)
Downstram Exon
ENSMUSE00000336306 (Chr2:113960388..113960555 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAACCCAACATCGGTGAAAA Chr2:113962680..113962699 60.21 40 GTGCCGTAAGGTTTTGTTGG Chr2:113960473..113960492 60.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000338788 Chr2:114000828..114001055 TACGAGCCTCTGGTCAGCTT Chr2:114000920..114000939 60.16 55
upstream ENSMUSE00000352890 Chr2:113998427..113998483 GCATGTAAATACTGGGCTCCTC Chr2:113998459..113998480 59.99 50
upstream ENSMUSE00000414203 Chr2:113995763..113995803 No primer for this exon
upstream ENSMUSE00000371083 Chr2:113991929..113991964 TTGCCATCAGGAAAATAATGC Chr2:113991942..113991962 59.92 38.1
upstream ENSMUSE00000412198 Chr2:113987300..113987420 AAGTTTCCAGCAAGGCCTATT Chr2:113987359..113987379 59.28 42.86
upstream ENSMUSE00000363907 Chr2:113984606..113984746 CATCTTGAAAGCGGCCTTAG Chr2:113984683..113984702 59.97 50
upstream ENSMUSE00000341051 Chr2:113983276..113983344 CTTATCTCGCTCCCGATGTG Chr2:113983292..113983311 60.76 55
upstream ENSMUSE00000382013 Chr2:113981983..113982083 AGATGGACCCAGAAGCAAGA Chr2:113981988..113982007 59.8 50
upstream ENSMUSE00000338391 Chr2:113980701..113980777 CATCTCCGTGTTGAAGTCCA Chr2:113980713..113980732 59.68 50
upstream ENSMUSE00000388454 Chr2:113977255..113977319 GTCACCATGGACAAGGTTCA Chr2:113977295..113977314 59.37 50
upstream ENSMUSE00000345146 Chr2:113976135..113976251 CCACCTTCTGGTTCACTGCT Chr2:113976185..113976204 60.3 55
upstream ENSMUSE00000385981 Chr2:113974675..113974788 AACGAGATGACCACGATTCA Chr2:113974700..113974719 59.09 45
upstream ENSMUSE00000342596 Chr2:113972625..113972728 CCCGAGCTCTATGACTTTGC Chr2:113972688..113972707 59.98 55
upstream ENSMUSE00000413774 Chr2:113971364..113971466 CCAACGCTCCCTAAAAATGA Chr2:113971404..113971423 60.07 45
upstream ENSMUSE00000370696 Chr2:113968724..113968844 CGCATCTCTCAAATTCAGCA Chr2:113968807..113968826 60.1 45
upstream ENSMUSE00000661884 Chr2:113966605..113966746 TCTCCCCAAGTTGAATCTGC Chr2:113966717..113966736 60.19 50
upstream ENSMUSE00000661883 Chr2:113962606..113962784 AAACCCAACATCGGTGAAAA Chr2:113962680..113962699 60.21 40

*** Putative Vector Insertion (Chr 2: 113960556 - 113962605) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000336306 Chr2:113960388..113960555 GTGCCGTAAGGTTTTGTTGG Chr2:113960473..113960492 60.4 50
downstream ENSMUSE00000298414 Chr2:113958703..113958872 ATCTTCGGCTCCGTTTTGTA Chr2:113958738..113958757 59.71 45
downstream ENSMUSE00000298408 Chr2:113956271..113956512 ATTCCGAATCGTCTCCAACA Chr2:113956467..113956486 60.46 45
downstream ENSMUSE00000298403 Chr2:113953249..113953395 TTTGGGCTGGTTGTAAGGAT Chr2:113953229..113953248 59.43 45
downstream ENSMUSE00000342504 Chr2:113952692..113952761 CGGATGGCCTCTATCTGTGTAT Chr2:113952698..113952719 60.36 50
downstream ENSMUSE00000298387 Chr2:113951627..113951737 TGATCTGGACTGCAACATCTG Chr2:113951667..113951687 59.85 47.62
downstream ENSMUSE00000298378 Chr2:113946941..113947050 TGGCGCTCATCAATGTCTAA Chr2:113946976..113946995 60.37 45
downstream ENSMUSE00000298372 Chr2:113945646..113945781 AATAGCCGGCAGTTTCACAG Chr2:113945638..113945657 60.27 50
downstream ENSMUSE00000298362 Chr2:113944413..113944634 CTGAGGAGCATTGGCAAAAT Chr2:113944481..113944500 60.21 45
downstream ENSMUSE00000298351 Chr2:113942259..113942396 TGACCAAGTCGTGTCGTTTC Chr2:113942251..113942270 59.73 50
downstream ENSMUSE00000298337 Chr2:113940316..113940387 GAATCTGAGCAGCCTCTTCC Chr2:113940329..113940348 59.12 55
downstream ENSMUSE00000298328 Chr2:113938955..113939142 TGATCGCCAATCATAATCCA Chr2:113939068..113939087 59.85 40
downstream ENSMUSE00000298317 Chr2:113938218..113938389 AGGGTTAGGCTCCGACTCTC Chr2:113938208..113938227 59.84 60
downstream ENSMUSE00000396817 Chr2:113935620..113935790 GATGTCCCGAATCAGATGCT Chr2:113935646..113935665 60.04 50
downstream ENSMUSE00000353402 Chr2:113933840..113933925 CTGCTGACCCTGGAATCTGT Chr2:113933871..113933890 60.26 55
downstream ENSMUSE00000394173 Chr2:113931536..113931710 CGAAGATGTAAAGGCCAAGC Chr2:113931630..113931649 59.85 50
downstream ENSMUSE00000685911 Chr2:113930936..113931097 CAAGAGAAGTGCCGGAGAAG Chr2:113931049..113931068 60.13 55
downstream ENSMUSE00000436047 Chr2:113929740..113929853 CCATCTGGGGCATGTTCTTA Chr2:113929777..113929796 60.85 50
downstream ENSMUSE00000436041 Chr2:113926911..113927465 ACCTTGAGCAGACACGGTTT Chr2:113927342..113927361 59.77 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr2:113962536..113962556 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAGTGATGCCACCTTTTGC Chr2:113962568..113962588 60.12 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040383