Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12013
Trapped Gene
D230025D16Rik (ENSMUSG00000031889)
Vector Insertion
Chr 8: 107749387 - 107755027
Public Clones (sanger) (sanger) (sanger) E044H08 (ggtc) D085B11 (ggtc) P010E10 (ggtc)
D111C11 (ggtc) D085B11 (ggtc) E127F10 (ggtc) D086E12 (ggtc) (ggtc)
CMHD-GT_473F9-3 (cmhd) PST21736-NR (escells) IST14794C8 (tigm) IST12850D6 (tigm)
IST14447B7 (tigm)
Private Clones OST448374 (lexicon) OST441531 (lexicon) OST324982 (lexicon) OST202423 (lexicon)
OST189355 (lexicon) OST30457 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000405558 (Chr8:107749099..107749386 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAGCAATGGGAATTCACTC Chr8:107749364..107749383 60.6 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000405558 (Chr8:107749099..107749386 +)
Downstram Exon
ENSMUSE00000236963 (Chr8:107755028..107755110 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAGCAATGGGAATTCACTC Chr8:107749364..107749383 60.6 50 CTGATGATGCGACAGTGCTT Chr8:107755085..107755104 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000405558 Chr8:107749099..107749386 CGAGCAATGGGAATTCACTC Chr8:107749364..107749383 60.6 50

*** Putative Vector Insertion (Chr 8: 107749387 - 107755027) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000236963 Chr8:107755028..107755110 CTGATGATGCGACAGTGCTT Chr8:107755085..107755104 60.02 50
downstream ENSMUSE00000236942 Chr8:107758382..107758465 GTGTGATCCCGTCCTGAGTC Chr8:107758436..107758455 60.54 60
downstream ENSMUSE00000236921 Chr8:107762323..107762366 No primer for this exon
downstream ENSMUSE00000236900 Chr8:107763571..107763650 GAGCGATGGCCTGAGAGTTA Chr8:107763605..107763624 60.5 55
downstream ENSMUSE00000236883 Chr8:107763878..107763972 CCTCCGTCCACGAGTCTAAC Chr8:107763961..107763980 59.72 60
downstream ENSMUSE00000236858 Chr8:107764741..107764838 AAGCTAGACCATGGGCAAAA Chr8:107764768..107764787 59.71 45
downstream ENSMUSE00000236840 Chr8:107764927..107765039 GGTCCAGTTCCATCTCGAAG Chr8:107765010..107765029 59.65 55
downstream ENSMUSE00000214347 Chr8:107770321..107770454 CGCACGCTCAAATACTCTCA Chr8:107770376..107770395 60.16 50
downstream ENSMUSE00000214340 Chr8:107770738..107770821 GTTGCACTTGGACGGAACTT Chr8:107770791..107770810 60.16 50
downstream ENSMUSE00000214342 Chr8:107771996..107772078 TGCCCAGGGTAATTGGTATG Chr8:107772066..107772085 60.58 50
downstream ENSMUSE00000214344 Chr8:107772643..107772686 TGAACTCACAGCGGTGGTAA Chr8:107772665..107772684 60.3 50
downstream ENSMUSE00000214348 Chr8:107773319..107773362 CAGTCTGACCACCTGCATTTT Chr8:107773341..107773361 60.16 47.62
downstream ENSMUSE00000214346 Chr8:107773497..107773555 GCAAGACAACAGGCTTCTCC Chr8:107773554..107773573 60 55
downstream ENSMUSE00000214341 Chr8:107774619..107774691 GCCAAACGGATTGGTGTTAT Chr8:107774655..107774674 59.69 45
downstream ENSMUSE00000377433 Chr8:107775498..107776949 CTGTAGGCCCAGGAACCATA Chr8:107776741..107776760 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAGTGTGGGGTCTTTTGG Chr8:107752388..107752408 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAGTGTGGGGTCTTTTGG Chr8:107752388..107752408 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031889