Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12027
Trapped Gene
Cdc37l1 (ENSMUSG00000024780)
Vector Insertion
Chr 19: 29073842 - 29081461
Public Clones (sanger) A044A08 (ggtc) IST13059A10 (tigm) IST12568E3 (tigm) IST11009H3 (tigm)
IST11009H3 (tigm) IST14856F4 (tigm)
Private Clones OST459744 (lexicon) OST147699 (lexicon) OST54807 (lexicon) OST43580 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000144926 (Chr19:29073751..29073841 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000144926 (Chr19:29073751..29073841 +)
Downstram Exon
ENSMUSE00000144922 (Chr19:29081462..29081577 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACATACGAGGTGTGGGTGGT Chr19:29081526..29081545 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000408401 Chr19:29064984..29065159 CGTCCCACTACTCTCCGGTA Chr19:29065122..29065141 60.13 60
upstream ENSMUSE00000144925 Chr19:29069531..29069812 GGAACATGGATGCCATTAGC Chr19:29069775..29069794 60.3 50
upstream ENSMUSE00000144926 Chr19:29073751..29073841 No primer for this exon

*** Putative Vector Insertion (Chr 19: 29073842 - 29081461) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000144922 Chr19:29081462..29081577 ACATACGAGGTGTGGGTGGT Chr19:29081526..29081545 60.16 55
downstream ENSMUSE00000144918 Chr19:29082063..29082185 TGTTCCATTAGAGCGCCTTT Chr19:29082085..29082104 59.85 45
downstream ENSMUSE00000489299 Chr19:29086379..29086543 CAGAATGGGGGACATGATTC Chr19:29086508..29086527 60.13 50
downstream ENSMUSE00000444339 Chr19:29090496..29092059 GTAGGTCACCACTGCGGATT Chr19:29091097..29091116 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTAATCGCCTTGCAGCAC Chr19:29076890..29076910 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGATCATTGGTCGTGACTGG Chr19:29076881..29076902 60.53 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024780