Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12044
Trapped Gene
Zfp280b (ENSMUSG00000049764)
Vector Insertion
Chr 10: 75495495 - 75500978
Public Clones E326A02 (ggtc) D160A01 (ggtc) (ggtc) W221A03 (ggtc) E123A08 (ggtc)
D029E07 (ggtc) E326A02 (ggtc) D160D01 (ggtc) IST10439D3 (tigm) IST13394C6 (tigm)
IST10111C4 (tigm) IST12776B4 (tigm) IST12776B4 (tigm) IST13439E8 (tigm)
Private Clones OST447611 (lexicon) OST283440 (lexicon) OST271886 (lexicon) OST236613 (lexicon)
OST233839 (lexicon) OST210223 (lexicon) OST186838 (lexicon) OST41342 (lexicon)
OST41331 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000642479 (Chr10:75495399..75495494 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000642479 (Chr10:75495399..75495494 +)
Downstram Exon
ENSMUSE00000352656 (Chr10:75500979..75505879 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGACTCGGACAAAGGCTCAA Chr10:75501429..75501448 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000642479 Chr10:75495399..75495494 No primer for this exon

*** Putative Vector Insertion (Chr 10: 75495495 - 75500978) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000352656 Chr10:75500979..75505879 AGACTCGGACAAAGGCTCAA Chr10:75501429..75501448 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr10:75495546..75495566 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000049764