Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12046
Trapped Gene
Gcnt1 (ENSMUSG00000038843)
Vector Insertion
Chr 19: 17407747 - 17431046
Public Clones W117C04 (ggtc) IST12878A10 (tigm) IST11786D8 (tigm) IST13952A11 (tigm)
IST12502A10 (tigm) IST10613G3 (tigm) IST12878A10 (tigm) IST13952A11 (tigm)
IST12839A2 (tigm) IST12452D2 (tigm) IST13056B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000498805 (Chr19:17431047..17431107 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000498805 (Chr19:17431047..17431107 -)
Downstram Exon
ENSMUSE00000230275 (Chr19:17407600..17407746 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGGAATATTGTGCTGCCAAG Chr19:17407648..17407667 60.47 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000498805 Chr19:17431047..17431107 No primer for this exon

*** Putative Vector Insertion (Chr 19: 17407747 - 17431046) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000230275 Chr19:17407600..17407746 GGGAATATTGTGCTGCCAAG Chr19:17407648..17407667 60.47 50
downstream ENSMUSE00000444845 Chr19:17403165..17404978 TGACCACGAAGTAGGCACTG Chr19:17403954..17403973 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAAGCAGCGGAGAAGTGTG Chr19:17416075..17416095 60.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACAGCACGTGACTGGGAAA Chr19:17415982..17416002 62.29 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATGCCCACCACCCATTA Chr19:17425131..17425151 59.9 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATAATGCCCACCACCCATTA Chr19:17425131..17425151 59.9 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038843