Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12061
Trapped Gene
Tmod3 (ENSMUSG00000058587)
Vector Insertion
Chr 9: 75364403 - 75377175
Public Clones A041C03 (ggtc) W095C07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275433 (Chr9:75377176..75377332 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGACCGGGACGATTATGTG Chr9:75377198..75377217 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275433 (Chr9:75377176..75377332 -)
Downstram Exon
ENSMUSE00000468553 (Chr9:75364280..75364402 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGACCGGGACGATTATGTG Chr9:75377198..75377217 59.81 50 TGGCTTCTGTTTGGGGATAA Chr9:75364352..75364371 60.44 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000275468 Chr9:75407307..75407464 GTGAAGGGGAACCAGCAATA Chr9:75407444..75407463 59.93 50
upstream ENSMUSE00000275452 Chr9:75380233..75380399 TAACCCGTGGTGGAAGTAGC Chr9:75380377..75380396 59.99 55
upstream ENSMUSE00000275433 Chr9:75377176..75377332 AAGACCGGGACGATTATGTG Chr9:75377198..75377217 59.81 50

*** Putative Vector Insertion (Chr 9: 75364403 - 75377175) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000468553 Chr9:75364280..75364402 TGGCTTCTGTTTGGGGATAA Chr9:75364352..75364371 60.44 45
downstream ENSMUSE00000471409 Chr9:75362974..75363063 CAGAACGGTGTGTCTGCAAT Chr9:75362999..75363018 59.75 50
downstream ENSMUSE00000508427 Chr9:75358933..75359063 ACTTCAACAAGACGGGCATC Chr9:75358930..75358949 60.12 50
downstream ENSMUSE00000511391 Chr9:75357121..75357228 ATGTTTCACATGCGTGTTGG Chr9:75357141..75357160 60.44 45
downstream ENSMUSE00000510487 Chr9:75355188..75355331 TTGAGCTCCATCAGGGTCTC Chr9:75355179..75355198 60.35 55
downstream ENSMUSE00000513506 Chr9:75352647..75352791 TGTTCTTCGTTATCGCGTTG Chr9:75352634..75352653 59.87 45
downstream ENSMUSE00000473795 Chr9:75345926..75347957 ACAGGCACCGTAGGAAAATG Chr9:75345939..75345958 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCATTTAATCGCCTTGCAG Chr9:75365110..75365131 60.21 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCATTCGTGACTGGGAAAA Chr9:75365110..75365130 59.1 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058587