Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12063
Trapped Gene
Cks2 (ENSMUSG00000062248)
Vector Insertion
Chr 13: 51740841 - 51744953
Public Clones 5SP119E04 (ggtc) W239E01 (ggtc) CMHD-GT_373B3-3 (cmhd) CMHD-GT_290C3-3 (cmhd)
FHCRC-GT-S16-3G1 (fhcrc) FHCRC-GT-S9-9C1 (fhcrc) FHCRC-GT-S15-11A1 (fhcrc)
FHCRC-GT-S8-5B1 (fhcrc) FHCRC-GT-S19-12C1 (fhcrc) FHCRC-GT-S11-10E1 (fhcrc)
FHCRC-GT-S16-10B1_B10 (fhcrc) FHCRC-GT-S9-1G1 (fhcrc) FHCRC-GT-S12-12B1 (fhcrc)
FHCRC-GT-S5-1F1 (fhcrc) FHCRC-GT-S16-7D1 (fhcrc) FHCRC-GT-S10-7E1 (fhcrc)
FHCRC-GT-S15-7F1 (fhcrc) FHCRC-GT-S7-10F1 (fhcrc) FHCRC-GT-S19-7D1 (fhcrc)
FHCRC-GT-S11-9D1 (fhcrc) FHCRC-GT-S3-11F1 (fhcrc) IST14550A9 (tigm)
Private Clones OST436757 (lexicon) OST413945 (lexicon) OST391467 (lexicon) OST377887 (lexicon)
OST375124 (lexicon) OST366175 (lexicon) OST339283 (lexicon) OST334057 (lexicon)
OST283734 (lexicon) OST245958 (lexicon) OST233078 (lexicon) OST231561 (lexicon)
OST201709 (lexicon) OST142849 (lexicon) OST62837 (lexicon) OST62828 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682511 (Chr13:51740694..51740840 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATCCCGCTTACTCCTCTG Chr13:51740750..51740769 60.35 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682511 (Chr13:51740694..51740840 +)
Downstram Exon
ENSMUSE00000493444 (Chr13:51744954..51745081 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATCCCGCTTACTCCTCTG Chr13:51740750..51740769 60.35 55 TCCACTCCTCTTCGGACATC Chr13:51745027..51745046 60.2 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682511 Chr13:51740694..51740840 TGATCCCGCTTACTCCTCTG Chr13:51740750..51740769 60.35 55

*** Putative Vector Insertion (Chr 13: 51740841 - 51744953) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000493444 Chr13:51744954..51745081 TCCACTCCTCTTCGGACATC Chr13:51745027..51745046 60.2 55
downstream ENSMUSE00000682509 Chr13:51745706..51746023 GATCCCAGCTGCACTTCATT Chr13:51745776..51745795 60.23 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACAT Chr13:51740890..51740911 60.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACTTATACGTGACTGGGAAAACC Chr13:51740884..51740908 58.57 41.67 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062248