Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI12064
Trapped Gene
Sertad1 (ENSMUSG00000008384)
Vector Insertion
Chr 7: 28272098 - 28274271
Public Clones (sanger) D110F07 (ggtc) (ggtc) D183G12 (ggtc) D110F07 (ggtc)
(ggtc) D183G12 (ggtc) W242B04 (ggtc) IST14140A3 (tigm)
Private Clones OST448534 (lexicon) OST374322 (lexicon) OST284852 (lexicon) OST279594 (lexicon)
OST274151 (lexicon) OST230364 (lexicon) OST198209 (lexicon) OST197789 (lexicon)
OST177176 (lexicon) OST169609 (lexicon) OST138383 (lexicon) OST116389 (lexicon)
OST6922 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000201123 (Chr7:28271972..28272097 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000201123 (Chr7:28271972..28272097 +)
Downstram Exon
ENSMUSE00000391319 (Chr7:28274272..28275330 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000201123 Chr7:28271972..28272097 No primer for this exon

*** Putative Vector Insertion (Chr 7: 28272098 - 28274271) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391319 Chr7:28274272..28275330 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr7:28272148..28272168 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTCCCTCTTCGTTCTGATT Chr7:28272062..28272082 58.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008384